[BioC] Lumi problem - 'Annotation columns not available'

Atul Kakrana atulkakrana at outlook.com
Tue Apr 23 19:49:14 CEST 2013


Hi Pan,

Thanks for replying. Please see attached file with first 100 lines of
FinalReport.txt.

Awaiting response.

AK

On 04/23/2013 11:53 AM, Pan Du wrote:
> Hi Atul
>
> Can you send me to the top 100 rows of your data file? I cannot tell
> the reason without seeing your data. Thanks for reporting this!
>
> Pan
>
>
> Date: Mon, 22 Apr 2013 13:28:21 -0400
> From: Atul Kakrana <atulkakrana at outlook.com
> <mailto:atulkakrana at outlook.com>>
> To: "bioconductor at r-project.org <mailto:bioconductor at r-project.org>"
> <bioconductor at r-project.org <mailto:bioconductor at r-project.org>>
> Subject: [BioC] Lumi problem - 'Annotation columns not available'
> Message-ID: <BLU0-SMTP39586425625757CB11593A1ADCB0 at phx.gbl>
> Content-Type: text/plain; charset="ISO-8859-1"
>
> Hello All,
>
> I am trying to input the Illumina Microarray data using 'lumi' but
> getting an error:
>
> > mydata_test <-
> lumiR.batch(filename,sep='\t',convertNuID=FALSE,inputAnnotation=TRUE,annotationColumn
> =
> c('PROBE_ID','ACCESSION','SYMBOL','ENTREZ_GENE_ID','PROBE_START','CHROMOSOME'))
> Inputting the data ...
> Inputting the data ...
> Annotation columns are not available in the data.
> Perform Quality Control assessment of the LumiBatch object ...
>
> This error is not new to me as I had this problem before as well. But
> that time I ignored it and later in analysis used 'lumiMouseAll.db'
> package for annotations. The final results had incomplete (missing)
> annotations.
>
> This time I really need complete annotations and therefore trying to
> import annotations as provided by Beadstudio rather than using
> 'lumiMouseAll.db'. Please tell me what is the problem as I checked all
> the mentioned columns does exist in rawfile.
>
> >sessionInfo()
>
> R version 2.15.3 (2013-03-01)
> Platform: x86_64-pc-linux-gnu (64-bit)
>
> locale:
>  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C
> LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8
> LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8
> LC_PAPER=C
>  [8] LC_NAME=C                  LC_ADDRESS=C
> LC_TELEPHONE=C             LC_MEASUREMENT=en_US.UTF-8
> LC_IDENTIFICATION=C
>
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods   base
>
> other attached packages:
>  [1] lumiMouseIDMapping_1.10.0 illuminaMousev1.db_1.16.1
> illuminaMousev2.db_1.16.1 lumiMouseAll.db_1.18.0
> org.Mm.eg.db_2.8.0        calibrate_1.7.1
> scatterplot3d_0.3-33
>  [8] affyQCReport_1.36.0       lattice_0.20-13
> farms_1.10.0              MASS_7.3-23
> genefilter_1.40.0         R2HTML_2.2
> annotate_1.36.0
> [15] affycoretools_1.30.0      KEGG.db_2.8.0
> affy_1.36.1               GO.db_2.8.0
> RSQLite_0.11.2            DBI_0.2-5
> AnnotationDbi_1.20.7
> [22] limma_3.14.4              lumi_2.10.0
> nleqslv_2.0               Biobase_2.18.0
> BiocGenerics_0.4.0
>
> loaded via a namespace (and not attached):
>  [1] affyio_1.26.0         affyPLM_1.34.0        annaffy_1.30.0
> AnnotationForge_1.0.3 BiocInstaller_1.8.3   biomaRt_2.14.0
> Biostrings_2.26.3     Category_2.24.0
>  [9] colorspace_1.2-1      gcrma_2.30.0          gdata_2.12.0
> GOstats_2.24.0        gplots_2.11.0         graph_1.36.2
> grid_2.15.3           GSEABase_1.20.2
> [17] gtools_2.7.0          IRanges_1.16.6        KernSmooth_2.23-10
> Matrix_1.0-11         methylumi_2.4.0       mgcv_1.7-22
> nlme_3.1-108          parallel_2.15.3
> [25] preprocessCore_1.20.0 RBGL_1.34.0           RColorBrewer_1.0-5
> RCurl_1.95-4.1        simpleaffy_2.34.0     splines_2.15.3
> stats4_2.15.3         survival_2.37-4
> [33] tools_2.15.3          XML_3.95-0.2          xtable_1.7-1
> zlibbioc_1.4.0
>
> AK
>

-------------- next part --------------
[Header]
GSGX Version	1.9.0
Report Date	7/30/2012 1:38:22 PM
Project	MosueWG-6
Group Set	MouseWG-6
Analysis	MouseWg-6
Normalization	none
[Sample Probe Profile]
TargetID	ProbeID	WB1.AVG_Signal	WB1.NARRAYS	WB1.ARRAY_STDEV	WB1.BEAD_STDERR	WB1.Avg_NBEADS	WB1.Detection Pval	WB2.AVG_Signal	WB2.NARRAYS	WB2.ARRAY_STDEV	WB2.BEAD_STDERR	WB2.Avg_NBEADS	WB2.Detection Pval	T1.AVG_Signal	T1.NARRAYS	T1.ARRAY_STDEV	T1.BEAD_STDERR	T1.Avg_NBEADS	T1.Detection Pval	T2.AVG_Signal	T2.NARRAYS	T2.ARRAY_STDEV	T2.BEAD_STDERR	T2.Avg_NBEADS	T2.Detection Pval	C1.AVG_Signal	C1.NARRAYS	C1.ARRAY_STDEV	C1.BEAD_STDERR	C1.Avg_NBEADS	C1.Detection Pval	C2.AVG_Signal	C2.NARRAYS	C2.ARRAY_STDEV	C2.BEAD_STDERR	C2.Avg_NBEADS	C2.Detection Pval	SPECIES	SOURCE	SEARCH_KEY	TRANSCRIPT	ILMN_GENE	SOURCE_REFERENCE_ID	REFSEQ_ID	UNIGENE_ID	ENTREZ_GENE_ID	GI	ACCESSION	SYMBOL	PROTEIN_PRODUCT	PROBE_ID	ARRAY_ADDRESS_ID	PROBE_TYPE	PROBE_START	PROBE_SEQUENCE	CHROMOSOME	PROBE_CHR_ORIENTATION	PROBE_COORDINATES	CYTOBAND	DEFINITION	ONTOLOGY_COMPONENT	ONTOLOGY_PROCESS	ONTOLOGY_FUNCTION	SYNONYMS	
0610005C13RIK	870465	52.7	1	NaN	3.085	37	0.17415	49.3	1	NaN	2.112	36	0.18269	43.1	1	NaN	1.636	42	0.51068	39.9	1	NaN	1.549	40	0.77137	42.3	1	NaN	1.505	50	0.50641	41.0	1	NaN	1.506	48	0.39103	Mus musculus	MEEBO	ILMN_184313	ILMN_184313	0610005C13RIK	scl31370.6.1_3						0610005C13Rik		ILMN_2417611	000870465	S	3	TTTGCAGTTCCACCCCTTACCTAGGGTGTGCGGAAGCTGGGGCGCCCCGT										
0610005I04	3190307	56.4	1	NaN	2.645	48	0.08974	53.9	1	NaN	2.149	61	0.08013	49.2	1	NaN	1.811	45	0.08868	45.5	1	NaN	1.651	51	0.25641	47.9	1	NaN	1.739	58	0.10577	45.6	1	NaN	2.093	49	0.08226	Mus musculus	MEEBO	ILMN_223307	ILMN_223307	0610005I04	scl29691.6.1_260	NM_177579.2			31341435	NM_177579.2	0610005I04		ILMN_2762289	003190307	S	1431	TTCTGGATAGGAGAGGGGATATTGTATTGATTCACCCCATCTTGTGTCAC										
0610006I08RIK	1940731	6036.0	1	NaN	150.909	47	0.00000	2725.9	1	NaN	66.145	32	0.00000	1059.1	1	NaN	33.581	43	0.00000	957.1	1	NaN	30.964	43	0.00000	1415.6	1	NaN	28.745	51	0.00000	803.0	1	NaN	16.654	42	0.00000	Mus musculus	RefSeq	ILMN_220369	ILMN_220369	0610006I08RIK	NM_025791.1	NM_025791.1		66836	13385261	NM_025791.1	0610006I08Rik	NP_080067.1	ILMN_2896528	001940731	S	521	GGCCGGCGCTTCTACTTCCTTTTGGACAAAGCTGGACACTTTCCCAACAC	19	+	8846738-8846787	19qA	Mus musculus RIKEN cDNA 0610006I08 gene (0610006I08Rik), mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]				
0610006I08RIK	3120133	1465.3	1	NaN	34.690	31	0.00000	758.8	1	NaN	17.046	40	0.00000	332.1	1	NaN	9.985	42	0.00000	315.7	1	NaN	9.414	46	0.00000	430.4	1	NaN	15.125	28	0.00000	250.7	1	NaN	6.978	49	0.00000	Mus musculus	RefSeq	ILMN_220369	ILMN_220369	0610006I08RIK	NM_025791.1	NM_025791.1		66836	13385261	NM_025791.1	0610006I08Rik	NP_080067.1	ILMN_2721178	003120133	S	190	GACCTCCCTGGCTGTTGCAGCCTTGTCCAGACCTCTGAGCCGAGTACCTG	19	+	8845675-8845724	19qA	Mus musculus RIKEN cDNA 0610006I08 gene (0610006I08Rik), mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]				
0610006L08RIK	2070673	40.7	1	NaN	1.463	54	0.93483	43.5	1	NaN	2.065	53	0.61111	38.0	1	NaN	1.327	47	0.92308	42.5	1	NaN	1.365	55	0.52244	43.5	1	NaN	1.624	51	0.39957	41.8	1	NaN	1.663	56	0.31624	Mus musculus	MEEBO	ILMN_189155	ILMN_189155	0610006L08RIK	scl31173.6_20						0610006L08Rik		ILMN_2458837	002070673	S	5	GGAAGCCCCGCTTCTTCAGCATAACACACGAGCTCTCAGATCTTCCAATG										
0610007C21RIK	1690678	597.1	1	NaN	16.396	49	0.00000	297.3	1	NaN	7.820	44	0.00000	257.8	1	NaN	7.751	41	0.00000	230.2	1	NaN	7.652	44	0.00000	313.5	1	NaN	9.085	48	0.00000	212.2	1	NaN	6.402	41	0.00000	Mus musculus	RefSeq	ILMN_244468	ILMN_244468	0610007C21RIK	NM_027855.2	NM_027855.2		381629	47087145	NM_027855.2	0610007C21Rik	NP_082131.2	ILMN_3033922	001690678	I	139	GCTTACTGTGAGGATACATCGAAGCTAATGCAGGCCCGATGCTGCCTGAA	5	+	31351883-31351932	5qB1	Mus musculus RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 1, mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA]			AI316792; HSPC013; Apr3; p18	
0610007C21RIK	2710446	2529.8	1	NaN	64.796	40	0.00000	1436.5	1	NaN	35.377	42	0.00000	1110.2	1	NaN	24.380	44	0.00000	931.1	1	NaN	27.293	45	0.00000	1367.4	1	NaN	28.572	46	0.00000	800.3	1	NaN	17.807	45	0.00000	Mus musculus	RefSeq	ILMN_229637	ILMN_229637	0610007C21RIK	NM_212470.2	NM_212470.2		381629	57526830	NM_212470.2	0610007C21Rik	NP_997635.1	ILMN_3092673	002710446	A	743	ATTGCACCACCTCGGGGGTCTTGTGGACACTTGGTTCAGGAGTGGACTCG	5	+	31356894-31356943	5qB1	Mus musculus RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 2, mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA]			AI316792; HSPC013; Apr3; p18	
0610007C21RIK	4150678	1651.7	1	NaN	52.634	53	0.00000	1028.1	1	NaN	25.872	47	0.00000	796.4	1	NaN	22.038	44	0.00000	649.0	1	NaN	18.213	53	0.00000	861.9	1	NaN	30.448	45	0.00000	542.2	1	NaN	17.725	51	0.00000	Mus musculus	RefSeq	ILMN_188157	ILMN_229637	0610007C21RIK	NM_212470.2	NM_212470.2		381629	57526830	NM_212470.2	0610007C21Rik	NP_997635.1	ILMN_1230777	004150678	S	747	CACCACCTCGGGGGTCTTGTGGACACTTGGTTCAGGAGTGGACTCGTACT	5	+	31356898-31356947	5qB1	Mus musculus RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 2, mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA]			AI316792; HSPC013; Apr3; p18	
0610007J10RIK	6550717	3409.5	1	NaN	95.300	41	0.00000	1356.0	1	NaN	51.564	43	0.00000	310.5	1	NaN	10.783	48	0.00000	293.4	1	NaN	8.715	52	0.00000	383.1	1	NaN	18.237	44	0.00000	250.3	1	NaN	11.318	41	0.00000	Mus musculus	Riken	ILMN_202711	ILMN_202711	0610007J10RIK	ri|0610007J10|R000001F05|AK018717|633					AK018717	0610007J10Rik		ILMN_1246069	006550717	S	1	GGCATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTCTGCGCCTGTG										
0610007L01RIK	2810427	45.1	1	NaN	1.992	56	0.69551	42.6	1	NaN	1.914	48	0.71368	41.8	1	NaN	1.331	55	0.65598	44.5	1	NaN	1.880	39	0.34722	43.0	1	NaN	2.200	34	0.43697	38.2	1	NaN	1.476	52	0.66346	Mus musculus	MEEBO	ILMN_195645	ILMN_195645	0610007L01RIK	scl27163.9.1_177				51711227	XM_355643	0610007L01Rik		ILMN_1232042	002810427	S	1	GAGCCTGAGAACCTATTTAAAACAACAAATCCCACAAAGTAACACTTCAT						Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]				
0610007L01RIK	3520577	629.5	1	NaN	28.648	51	0.00000	335.4	1	NaN	13.030	53	0.00000	195.1	1	NaN	7.333	52	0.00000	171.9	1	NaN	6.792	57	0.00000	196.4	1	NaN	6.706	56	0.00000	122.2	1	NaN	3.734	62	0.00000	Mus musculus	Riken	ILMN_201954	ILMN_201954	0610007L01RIK	ri|0610007L01|R000001M10|AK002297|1310					AK002297	0610007L01Rik		ILMN_1243193	003520577	S	1104	ATTTTGCCCTGAGAAGGTGGCTCTCGTGACGCCTAATCCTACAGCTCCCC						Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]				
0610007L01RIK	7160600	45.3	1	NaN	1.654	54	0.67415	44.1	1	NaN	1.471	49	0.56731	43.0	1	NaN	1.229	61	0.53098	38.9	1	NaN	1.308	45	0.84936	40.1	1	NaN	1.613	48	0.74786	37.7	1	NaN	1.500	55	0.72115	Mus musculus	MEEBO	ILMN_195645	ILMN_195645	0610007L01RIK	scl27163.9.1_177				51711227	XM_355643	0610007L01Rik		ILMN_2524361	007160600	S	868	GGACTGGTTCCTGTGCATCTTCACTCAGTCGGTCTTCAGGTATCACACAC						Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]				
0610007N19RIK	2000424	45.3	1	NaN	1.564	62	0.67415	44.4	1	NaN	1.624	51	0.53739	44.1	1	NaN	1.350	55	0.41026	44.1	1	NaN	1.630	64	0.38248	45.7	1	NaN	1.699	58	0.21261	41.8	1	NaN	1.695	62	0.31303	Mus musculus	RefSeq	ILMN_203840	ILMN_310171	0610007N19RIK	XM_001475444.1	XM_001475444.1		66835	149266519	XM_001475444.1	0610007N19Rik	XP_001475494.1	ILMN_1242440	002000424	S	504	CTGCCTCGACTTCCCTCGTAGTACACTGAAGAGGACCCTTGGAGCAGCTC				15qB3.1	PREDICTED: Mus musculus RIKEN cDNA 0610007N19 gene (0610007N19Rik), mRNA.					
0610007N19RIK	3850678	358.2	1	NaN	13.737	50	0.00000	93.1	1	NaN	4.609	45	0.00000	54.2	1	NaN	2.261	48	0.02350	51.6	1	NaN	2.109	51	0.02885	53.8	1	NaN	1.756	50	0.02137	42.4	1	NaN	1.643	44	0.25427	Mus musculus	RefSeq	ILMN_188213	ILMN_310171	0610007N19RIK	XM_001475444.1	XM_001475444.1		66835	149266519	XM_001475444.1	0610007N19Rik	XP_001475494.1	ILMN_1233188	003850678	S	1776	GATGGTTGACATAGACTGATCTACCTTCACCCACCCCAAGTGAGTTCTGC				15qB3.1	PREDICTED: Mus musculus RIKEN cDNA 0610007N19 gene (0610007N19Rik), mRNA.					
0610007N19RIK	6180301	679.3	1	NaN	14.674	50	0.00000	417.2	1	NaN	11.613	59	0.00000	189.7	1	NaN	5.458	65	0.00000	159.0	1	NaN	4.567	54	0.00000	220.6	1	NaN	5.732	61	0.00000	139.7	1	NaN	4.634	52	0.00000	Mus musculus	Riken	ILMN_201675	ILMN_201675	0610007N19RIK	ri|1810037G11|R000023J21|AK007719|212					AK007719	0610007N19Rik		ILMN_2543688	006180301	S	73	GAATGGAGCAGGGAGGAGCTGAAGAGAGCGTGGCTGGGAGACATGAAGAC										
0610007P08RIK	2120736	74.8	1	NaN	3.704	51	0.00534	62.7	1	NaN	2.163	52	0.02030	50.4	1	NaN	1.920	66	0.06624	49.3	1	NaN	1.724	46	0.07692	45.9	1	NaN	1.682	53	0.19979	37.9	1	NaN	1.618	50	0.70085	Mus musculus	RefSeq	ILMN_207376	ILMN_196322	0610007P08RIK	NM_023507.3	NM_023507.3		76251	91807127	NM_023507.3	0610007P08Rik	NP_075996.2	ILMN_1259789	002120736	S	1372	CTCACATCCTCTCAGCCTTGTACCTGTGGCAGTGGCCAGAAGCGCAGAAA	13	+	63945932-63945981	13qB3	Mus musculus RIKEN cDNA 0610007P08 gene (0610007P08Rik), transcript variant 2, mRNA.	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]	The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA]	Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA]	RAD26L; 1700019D06Rik	
0610007P08RIK	4610239	70.7	1	NaN	3.071	42	0.00962	55.5	1	NaN	1.952	42	0.06517	42.0	1	NaN	1.996	32	0.63889	43.2	1	NaN	1.577	35	0.46368	42.6	1	NaN	1.599	41	0.48611	33.4	1	NaN	1.916	21	0.97650	Mus musculus	RefSeq	ILMN_196322	ILMN_196322	0610007P08RIK	NM_023507.3	NM_023507.3		76251	91807127	NM_023507.3	0610007P08Rik	NP_075996.2	ILMN_2816356	004610239	S	2173	GGTGTCCACAACCTCTTCAAACTAAGGTCCCAAGGGTCATGTCTTACGAG	13	+	63970424-63970473	13qB3	Mus musculus RIKEN cDNA 0610007P08 gene (0610007P08Rik), transcript variant 2, mRNA.	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]	The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA]	Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA]	RAD26L; 1700019D06Rik	
0610007P08RIK	5420050	103.5	1	NaN	3.679	57	0.00000	72.9	1	NaN	2.368	45	0.00321	49.6	1	NaN	1.568	41	0.07906	44.3	1	NaN	1.451	62	0.35897	48.1	1	NaN	2.081	51	0.09936	40.7	1	NaN	1.347	60	0.41667	Mus musculus	MEEBO	ILMN_219797	ILMN_219797	0610007P08RIK	scl0076251.1_236				51767744	XM_484269	0610007P08Rik		ILMN_1224596	005420050	S	3044	GTGGCAGAGGGAATGGACCAGTTCCAAATCTCTTGTGTCTCGAGAACATG						A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]	The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA]	Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA]		
0610007P08RIK	6900500	49.7	1	NaN	2.006	63	0.31838	46.9	1	NaN	1.160	59	0.30235	42.8	1	NaN	1.209	57	0.55021	42.2	1	NaN	1.453	51	0.54167	43.9	1	NaN	1.426	68	0.35363	42.3	1	NaN	1.792	43	0.26282	Mus musculus	RefSeq	ILMN_196322	ILMN_196322	0610007P08RIK	NM_023507.2	NM_023507.2			31340591	NM_023507.2	0610007P08Rik		ILMN_1233643	006900500	S	1007	CAGTAACGCAAGTCAGCTGCAAGTCTCCTCATTCATCTTTGCCCAACACG						A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]	The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA]	Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA]		
0610007P14RIK	1230730	1447.4	1	NaN	37.610	36	0.00000	669.6	1	NaN	22.330	35	0.00000	93.6	1	NaN	4.668	39	0.00000	101.1	1	NaN	4.059	31	0.00000	93.4	1	NaN	4.093	29	0.00000	76.5	1	NaN	3.079	43	0.00000	Mus musculus	RefSeq	ILMN_239772	ILMN_239772	0610007P14RIK	NM_021446.1	NM_021446.1		58520	10946821	NM_021446.1	0610007P14Rik	NP_067421.1	ILMN_2808939	001230730	S	963	GGGCACAGGGCTGCTTCAAGGTCCTGAGCACATAGACTGGGCTCCTTTCT	12	-	86704730-86704779	12qD2	Mus musculus RIKEN cDNA 0610007P14 gene (0610007P14Rik), mRNA.	The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]	The chemical reactions and pathways resulting in the formation of sterols, steroids with one or more hydroxyl groups and a hydrocarbon side-chain in the molecule [goid 16126] [evidence IEA]; The chemical reactions and pathways resulting in the formation of steroids, compounds with a 1,2,cyclopentanoperhydrophenanthrene nucleus; includes de novo formation and steroid interconversion by modification [goid 6694] [evidence IEA]; The chemical reactions and pathways resulting in the formation of lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent [goid 8610] [evidence IEA]		AU019315; C77855; 1190004E09Rik; ORF11	
0610007P14RIK	4150367	1194.8	1	NaN	34.113	39	0.00000	513.6	1	NaN	11.807	47	0.00000	79.5	1	NaN	2.239	51	0.00000	81.6	1	NaN	2.059	50	0.00000	90.4	1	NaN	2.926	46	0.00000	71.3	1	NaN	1.922	59	0.00000	Mus musculus	RefSeq	ILMN_223911	ILMN_239772	0610007P14RIK	NM_021446.2	NM_021446.2		58520	133892239	NM_021446.2	0610007P14Rik	NP_067421.1	ILMN_2771349	004150367	S	8	GGAGCTGGCCTAGGGAGAGCTGGTTTGCGGATGCTGCTGATACTGCTGCA	12	-	87165438-87165487	12qD2	Mus musculus RIKEN cDNA 0610007P14 gene (0610007P14Rik), mRNA.	The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]	The chemical reactions and pathways resulting in the formation of sterols, steroids with one or more hydroxyl groups and a hydrocarbon side-chain in the molecule [goid 16126] [evidence IEA]; The chemical reactions and pathways resulting in the formation of steroids, compounds with a 1,2,cyclopentanoperhydrophenanthrene nucleus; includes de novo formation and steroid interconversion by modification [goid 6694] [evidence IEA]; The chemical reactions and pathways resulting in the formation of lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent [goid 8610] [evidence IEA]		AU019315; C77855; 1190004E09Rik; ORF11	
0610007P14RIK	4490064	1711.7	1	NaN	54.126	57	0.00000	780.2	1	NaN	19.808	65	0.00000	100.6	1	NaN	3.023	60	0.00000	104.8	1	NaN	3.326	54	0.00000	101.5	1	NaN	3.209	49	0.00000	76.3	1	NaN	2.857	65	0.00000	Mus musculus	RefSeq	ILMN_223911	ILMN_239772	0610007P14RIK	NM_021446.2	NM_021446.2		58520	133892239	NM_021446.2	0610007P14Rik	NP_067421.1	ILMN_2773981	004490064	S	964	GGGCAAGGGCTGCTTCAAGGTCCTGAGCACATAGACTGGGCTCCTTTCTA	12	-	87156576-87156625	12qD2	Mus musculus RIKEN cDNA 0610007P14 gene (0610007P14Rik), mRNA.	The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]	The chemical reactions and pathways resulting in the formation of sterols, steroids with one or more hydroxyl groups and a hydrocarbon side-chain in the molecule [goid 16126] [evidence IEA]; The chemical reactions and pathways resulting in the formation of steroids, compounds with a 1,2,cyclopentanoperhydrophenanthrene nucleus; includes de novo formation and steroid interconversion by modification [goid 6694] [evidence IEA]; The chemical reactions and pathways resulting in the formation of lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent [goid 8610] [evidence IEA]		AU019315; C77855; 1190004E09Rik; ORF11	
0610007P22RIK	1070170	771.6	1	NaN	33.840	40	0.00000	421.9	1	NaN	12.838	35	0.00000	80.0	1	NaN	3.480	38	0.00000	70.1	1	NaN	2.393	36	0.00000	80.9	1	NaN	3.716	54	0.00000	53.6	1	NaN	2.435	30	0.00855	Mus musculus	RefSeq	ILMN_213192	ILMN_213192	0610007P22RIK	NM_026676.1	NM_026676.1		68327	21489946	NM_026676.1	0610007P22Rik	NP_080952.1	ILMN_2634564	001070170	S	1050	CTGGTGTGCATTATTCAGAAGTGGCAGTAGGACCTGGGGATGGACGGGCC	17	+	24970285-24970334	17qA3.3	Mus musculus RIKEN cDNA 0610007P22 gene (0610007P22Rik), mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]			AL022759; MGC113771; 1110014B11Rik	
0610007P22RIK	3870091	129.1	1	NaN	4.432	57	0.00000	356.0	1	NaN	10.194	59	0.00000	121.6	1	NaN	2.969	60	0.00000	107.1	1	NaN	2.520	64	0.00000	105.4	1	NaN	2.870	68	0.00000	111.9	1	NaN	4.031	51	0.00000	Mus musculus	MEEBO	ILMN_186494	ILMN_186494	0610007P22RIK	scl000093.1_57						0610007P22Rik		ILMN_2435996	003870091	S	5	CCATCCCCAGGTCCTACTGCCACTTCTGAATAATGCACACCAGCTTCAAT						Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]				
0610007P22RIK	6590561	131.4	1	NaN	4.066	55	0.00000	351.9	1	NaN	7.615	64	0.00000	118.1	1	NaN	2.833	70	0.00000	109.6	1	NaN	2.720	60	0.00000	106.8	1	NaN	2.048	62	0.00000	113.2	1	NaN	2.935	70	0.00000	Mus musculus	RefSeq	ILMN_191546	ILMN_213192	0610007P22RIK	NM_026676.2	NM_026676.2		68327	142372926	NM_026676.2	0610007P22Rik	NP_080952.1	ILMN_2480021	006590561	S	1103	AGCAGGCCCGTCCATCCCCAGGTCCTACTGCCACTTCTGAATAATGCACA	17	+	25379683-25379732	17qA3.3	Mus musculus RIKEN cDNA 0610007P22 gene (0610007P22Rik), mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]			AL022759; MGC113771; 1110014B11Rik	
0610008C08RIK	2630593	55.0	1	NaN	3.976	25	0.10684	51.5	1	NaN	2.370	43	0.11859	44.7	1	NaN	1.824	39	0.35043	39.3	1	NaN	1.538	36	0.81517	40.7	1	NaN	1.620	27	0.66774	38.8	1	NaN	1.918	30	0.59722	Mus musculus	RefSeq	ILMN_221600	ILMN_221600	0610008C08RIK	NM_026673.2	NM_026673.2		68316	142368551	NM_026673.2	0610008C08Rik	NP_080949.1	ILMN_2737647	002630593	S	279	CGTGCCCACCTCCTCGGCTAATGCCCTTTTGGGGTTGTGGGGAGGATGAA	X	+	91612771-91612789:91612790-91612820	XqC3	Mus musculus RIKEN cDNA 0610008C08 gene (0610008C08Rik), mRNA.				RP23-272D10.2; MGC130105; MGC130106; 1110019O03Rik	
0610008F07RIK	4540673	54.2	1	NaN	2.460	47	0.12714	57.0	1	NaN	2.430	61	0.05235	47.9	1	NaN	1.589	53	0.13568	47.0	1	NaN	1.808	50	0.16453	48.3	1	NaN	1.437	52	0.09509	40.9	1	NaN	1.317	50	0.39423	Mus musculus	MEEBO	ILMN_222101	ILMN_222101	0610008F07RIK	scl18383.5.1_228	NM_197983.1			37574055	NM_197983.1	0610008F07Rik		ILMN_1236537	004540673	S	706	CACCTGTTGGGGCTAGTGCCATCGATATTGCCCGTGCTCAATTAAATATG										
0610009B14RIK	1170687	49.0	1	NaN	3.481	40	0.36004	43.1	1	NaN	3.007	39	0.65064	36.4	1	NaN	1.545	43	0.96688	33.7	1	NaN	1.386	46	0.99893	34.5	1	NaN	1.643	38	0.99038	33.9	1	NaN	1.496	46	0.96688	Mus musculus	MEEBO	ILMN_221704	ILMN_221704	0610009B14RIK	scl42290.2.1_321	XM_127006.1			20909473	XM_127006.1	0610009B14Rik		ILMN_2739275	001170687	S	863	CAGACCTCTCAGAAATGCTTATGATGCTGTCCCTTGAGGGTACTATGTGG										
0610009B22RIK	6280440	476.7	1	NaN	22.604	48	0.00000	202.9	1	NaN	9.803	45	0.00000	90.2	1	NaN	4.553	36	0.00000	96.2	1	NaN	4.653	48	0.00000	104.6	1	NaN	4.795	43	0.00000	76.5	1	NaN	3.532	49	0.00000	Mus musculus	RefSeq	ILMN_221361	ILMN_221361	0610009B22RIK	NM_025319.2	NM_025319.2		66050	141801968	NM_025319.2	0610009B22Rik	NP_079595.1	ILMN_2734484	006280440	S	403	TCTTCACTGACGTCTACGACTTATACATCAAATTTGCCATGAATCCCTTT	11	-	51499229-51499278	11qB1.3	Mus musculus RIKEN cDNA 0610009B22 gene (0610009B22Rik), mRNA.				RP23-79E13.7	
0610009D07RIK	3060092	181.6	1	NaN	6.447	45	0.00000	110.9	1	NaN	3.748	47	0.00000	54.4	1	NaN	2.108	38	0.02244	55.6	1	NaN	2.463	36	0.00534	62.3	1	NaN	2.105	57	0.00214	51.9	1	NaN	2.218	43	0.01496	Mus musculus	RefSeq	ILMN_218698	ILMN_218698	0610009D07RIK	NM_025323.2	NM_025323.2		66055	31981274	NM_025323.2	0610009D07Rik	NP_079599.1	ILMN_2952292	003060092	S	1065	CTTGCCTTGGTCATGATGTCTGCTCACAGCCTTAAAACCCTTAAAACACT	12	+	4834414-4834463	12qA1.1	Mus musculus RIKEN cDNA 0610009D07 gene (0610009D07Rik), mRNA.	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]	Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA]	Interacting selectively with an RNA molecule or a portion thereof [goid 3723] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]	6030419K15Rik; AV001342; Sf3b14	
0610009D07RIK	6290215	47.2	1	NaN	1.386	58	0.49359	48.1	1	NaN	2.275	40	0.23077	45.2	1	NaN	1.673	41	0.31410	43.8	1	NaN	1.831	39	0.41346	45.3	1	NaN	1.707	38	0.23932	41.2	1	NaN	1.785	39	0.37179	Mus musculus	RefSeq	ILMN_218698	ILMN_218698	0610009D07RIK	NM_025323.2	NM_025323.2		66055	31981274	NM_025323.2	0610009D07Rik	NP_079599.1	ILMN_2699078	006290215	S	608	TTAATTAGTACTGAATATTGTGATTTCTTATTTGAGAACTAGAATGACTT	12	+	4833957-4834006	12qA1.1	Mus musculus RIKEN cDNA 0610009D07 gene (0610009D07Rik), mRNA.	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]	Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA]	Interacting selectively with an RNA molecule or a portion thereof [goid 3723] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]	6030419K15Rik; AV001342; Sf3b14	
0610009D07RIK	6450369	52.0	1	NaN	2.762	45	0.20620	49.9	1	NaN	1.580	46	0.16239	40.4	1	NaN	1.517	53	0.79060	37.7	1	NaN	1.193	52	0.93376	39.1	1	NaN	1.568	57	0.82799	39.4	1	NaN	1.432	57	0.53419	Mus musculus	Riken	ILMN_202655	ILMN_202655	0610009D07RIK	ri|6030419K15|PX00056I06|AK020052|746					AK020052	0610009D07Rik		ILMN_2551266	006450369	S	256	GCGAATGTGAGTACCCCGCTTTTTGCGTGACAGGGAAGCGATGTTGTTGC						A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]	Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA]	Interacting selectively with an RNA molecule or a portion thereof [goid 3723] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]		
0610009J05RIK	110403	234.2	1	NaN	7.467	47	0.00000	81.9	1	NaN	2.366	46	0.00107	38.5	1	NaN	1.475	47	0.91239	38.8	1	NaN	1.416	49	0.85791	38.0	1	NaN	1.679	50	0.89103	35.3	1	NaN	1.309	44	0.91132	Mus musculus	Riken	ILMN_202257	ILMN_202257	0610009J05RIK	ri|0610009J05|R000002G03|AK002411|1570					AK002411	0610009J05Rik		ILMN_1257639	000110403	S	1412	TAAAAGAAGTGGGTGTTAGCCGGGCAGTGTTGGCGCATACCTTTAATCCC										
0610009L18RIK	6450296	57.9	1	NaN	2.548	42	0.07692	51.4	1	NaN	2.007	59	0.11966	47.8	1	NaN	2.088	42	0.14103	47.9	1	NaN	1.765	66	0.12073	50.5	1	NaN	1.778	48	0.04487	47.8	1	NaN	1.805	46	0.03205	Mus musculus	MEEBO	ILMN_191701	ILMN_191701	0610009L18RIK	scl40636.2.1_9						0610009L18Rik		ILMN_1233543	006450296	S	1	GCTGACGTTACAGTGTAATGAGTGAACTCCTCTGATGTCTTTGAAACTTT										
0610009O04RIK	3390392	69.0	1	NaN	2.639	60	0.01389	52.8	1	NaN	1.872	58	0.09722	47.2	1	NaN	1.803	57	0.17735	46.9	1	NaN	2.081	40	0.16774	48.0	1	NaN	1.740	41	0.10256	45.8	1	NaN	1.849	55	0.07479	Mus musculus	Riken	ILMN_202256	ILMN_202256	0610009O04RIK	ri|0610009O04|R000002E21|AK002431|1349					AK002431	0610009O04Rik		ILMN_1222927	003390392	S	1271	GGGAAGTGGGGTGGGGCCATCGATCAGTAGTAGAGCGTTTACCTAGCATG										
0610009O20RIK	2900228	659.5	1	NaN	16.097	52	0.00000	271.8	1	NaN	7.213	42	0.00000	86.9	1	NaN	3.514	43	0.00000	83.2	1	NaN	2.575	53	0.00000	89.5	1	NaN	3.046	42	0.00000	73.3	1	NaN	3.193	42	0.00000	Mus musculus	RefSeq	ILMN_220613	ILMN_220613	0610009O20RIK	NM_024179.4	NM_024179.4		66839	142383028	NM_024179.4	0610009O20Rik	NP_077141.2	ILMN_1213681	002900228	S	1911	CTCCTTGCTTAGGTTCCTGAAGACAGACTGGTGCCCACAGTTCCATGGCC	18	+	38421800-38421849	18qB3	Mus musculus RIKEN cDNA 0610009O20 gene (0610009O20Rik), mRNA.			The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA]	2700004E22Rik	
0610010D20RIK	2850424	52.8	1	NaN	3.101	37	0.17308	42.4	1	NaN	1.862	41	0.73397	38.6	1	NaN	1.935	35	0.91026	41.8	1	NaN	1.787	36	0.60150	38.2	1	NaN	2.041	35	0.87821	36.9	1	NaN	1.567	26	0.79808	Mus musculus	RefSeq	ILMN_221425	ILMN_221425	0610010D20RIK	NM_026152.1	NM_026152.1		67432	13385655	NM_026152.1	0610010D20Rik	NP_080428.1	ILMN_2735413	002850424	S	911	TGAAGAAAACCATGGACTGGTTTGGCTACTATGGAGGTCCCTGCCGCGCC	19	+	42144705-42144754	19qC3	Mus musculus RIKEN cDNA 0610010D20 gene (0610010D20Rik), mRNA.	A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA]	The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]	Catalysis of the cleavage of C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation, or conversely adding a group to a double bond. They differ from other enzymes in that two substrates are involved in one reaction direction, but only one in the other direction. When acting on the single substrate, a molecule is eliminated and this generates either a new double bond or a new ring [goid 16829] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]		
0610010D20RIK	3190008	60.4	1	NaN	2.916	48	0.04808	54.3	1	NaN	2.639	36	0.07479	41.8	1	NaN	1.891	40	0.65598	37.8	1	NaN	1.409	36	0.92842	44.8	1	NaN	1.870	36	0.28419	41.4	1	NaN	1.781	44	0.36004	Mus musculus	RefSeq	ILMN_221425	ILMN_221425	0610010D20RIK	NM_026152.1	NM_026152.1		67432	13385655	NM_026152.1	0610010D20Rik	NP_080428.1	ILMN_2735415	003190008	S	914	AAGAAAACCATGGACTGGTTTGGCTACTATGGAGGTCCCTGCCGCGCCCC	19	+	42144708-42144757	19qC3	Mus musculus RIKEN cDNA 0610010D20 gene (0610010D20Rik), mRNA.	A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA]	The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]	Catalysis of the cleavage of C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation, or conversely adding a group to a double bond. They differ from other enzymes in that two substrates are involved in one reaction direction, but only one in the other direction. When acting on the single substrate, a molecule is eliminated and this generates either a new double bond or a new ring [goid 16829] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]		
0610010D24RIK	7510674	60.8	1	NaN	2.569	48	0.04487	54.0	1	NaN	1.904	56	0.08013	41.4	1	NaN	2.017	36	0.69231	40.8	1	NaN	1.433	48	0.70192	41.4	1	NaN	1.399	49	0.60791	35.8	1	NaN	1.399	46	0.87607	Mus musculus	MEEBO	ILMN_213099	ILMN_213099	0610010D24RIK	scl068339.1_91				47087141	NM_026681	0610010D24Rik		ILMN_1237980	007510674	S	971	GCCAGCATTTGAAGTAGGCTGTAGATGTCATTCGTTGCATTTAGAGGCCC										
0610010E21RIK	3390088	1372.2	1	NaN	34.869	39	0.00000	382.8	1	NaN	12.486	36	0.00000	84.5	1	NaN	3.985	39	0.00000	80.6	1	NaN	3.615	33	0.00000	95.4	1	NaN	3.845	22	0.00000	62.5	1	NaN	3.563	42	0.00000	Mus musculus	RefSeq	ILMN_244634	ILMN_244634	0610010E21RIK	NM_001033140.3	NM_001033140.3		68332	111118962	NM_001033140.3	0610010E21Rik	NP_001028312.2	ILMN_2891688	003390088	S	773	CCCTGATGAACCGTGAGAAACTTGGCAGTCTGACTCGTTGTGAAGAACCG	7	-	31106572-31106621	7qB1	Mus musculus RIKEN cDNA 0610010E21 gene (0610010E21Rik), mRNA.				AW490662; AI430885	
0610010E21RIK	7160209	1078.7	1	NaN	62.973	43	0.00000	359.1	1	NaN	13.379	42	0.00000	85.6	1	NaN	3.060	46	0.00000	72.6	1	NaN	2.633	47	0.00000	88.1	1	NaN	4.152	39	0.00000	58.9	1	NaN	2.128	43	0.00214	Mus musculus	RefSeq	ILMN_192019	ILMN_244634	0610010E21RIK	NM_001033140.3	NM_001033140.3		68332	111118962	NM_001033140.3	0610010E21Rik	NP_001028312.2	ILMN_2484274	007160209	S	808	CGTTGTGAAGAACCGGGTTCATGAGGGAGATTACACTAGCTCATCTCAGC	7	-	31106537-31106586	7qB1	Mus musculus RIKEN cDNA 0610010E21 gene (0610010E21Rik), mRNA.				AW490662; AI430885	
0610010F05RIK	830088	43.6	1	NaN	1.982	67	0.81624	42.3	1	NaN	1.418	55	0.74038	41.3	1	NaN	1.542	50	0.70085	37.8	1	NaN	1.144	58	0.92628	41.4	1	NaN	1.308	69	0.60150	37.5	1	NaN	1.128	55	0.72970	Mus musculus	RefSeq	ILMN_192721	ILMN_238444	0610010F05RIK	NM_027860.2	NM_027860.2		71675	117956374	NM_027860.2	0610010F05Rik	NP_082136.2	ILMN_2490699	000830088	S	659	TGAAAACTGTACTGCTCGTAATGCTGGAGAAGAGACTGGAGAATCTGAAG	11	-	23522436-23522485	11qA3.2	Mus musculus RIKEN cDNA 0610010F05 gene (0610010F05Rik), mRNA.				RP23-188K3.6; mKIAA1841	
0610010F05RIK	3360209	444.5	1	NaN	17.926	41	0.00000	136.6	1	NaN	4.929	55	0.00000	51.0	1	NaN	2.128	38	0.05769	46.1	1	NaN	1.582	56	0.21154	48.6	1	NaN	1.890	54	0.08440	45.3	1	NaN	1.863	54	0.09615	Mus musculus	MEEBO	ILMN_217691	ILMN_217691	0610010F05RIK	scl0071675.1_286				50233766	NM_027860	0610010F05Rik		ILMN_2686463	003360209	S	4029	GATACATGGACAGGCATTTCTTCTGCCAAGTACGTTAAGGTTTTCCTTAC										
0610010F05RIK	5290564	113.2	1	NaN	3.826	71	0.00000	79.0	1	NaN	2.891	63	0.00214	50.9	1	NaN	1.598	76	0.05876	51.4	1	NaN	1.908	50	0.03098	52.8	1	NaN	1.680	55	0.02885	48.5	1	NaN	1.760	53	0.02885	Mus musculus	RefSeq	ILMN_216372	ILMN_238444	0610010F05RIK	NM_027860.2	NM_027860.2		71675	117956374	NM_027860.2	0610010F05Rik	NP_082136.2	ILMN_2712923	005290564	S	1702	CGCCTTCTTGCCCACCTGCTAAAATACTGGATGATCTGCACAAGCACAAA	11	-	23495418-23495467	11qA3.2	Mus musculus RIKEN cDNA 0610010F05 gene (0610010F05Rik), mRNA.				RP23-188K3.6; mKIAA1841	
0610010F05RIK	7650470	203.9	1	NaN	6.871	34	0.00000	108.4	1	NaN	3.879	49	0.00000	47.7	1	NaN	1.959	44	0.14850	51.8	1	NaN	1.782	53	0.02778	49.1	1	NaN	2.198	45	0.06731	48.4	1	NaN	2.024	46	0.02991	Mus musculus	MEEBO	ILMN_216372	ILMN_216372	0610010F05RIK	scl071675.1_1	XM_203572.3			38091312	XM_203572.3	0610010F05Rik		ILMN_2670313	007650470	S	1609	CTAGGCTTGAAGCACAAGTCAGAGCCTCAGTACCTGTCACTGCCCGGCAG										
0610010I05RIK	3990427	4635.3	1	NaN	184.725	50	0.00000	1080.4	1	NaN	42.592	58	0.00000	208.4	1	NaN	8.663	45	0.00000	204.6	1	NaN	6.683	51	0.00000	284.0	1	NaN	11.310	52	0.00000	168.9	1	NaN	6.830	48	0.00000	Mus musculus	Riken	ILMN_202718	ILMN_202718	0610010I05RIK	ri|0610010I05|R000002G18|AK018737|135					AK018737	0610010I05Rik		ILMN_2551741	003990427	S	82	AAACACATCAACTTCCCACTGTACACCACCACATCAATCAAATTCTCCTT										
0610010K06RIK	1500400	1246.1	1	NaN	31.227	47	0.00000	431.0	1	NaN	12.968	33	0.00000	104.3	1	NaN	3.131	54	0.00000	95.9	1	NaN	5.517	26	0.00000	129.3	1	NaN	4.443	43	0.00000	72.9	1	NaN	2.918	35	0.00000	Mus musculus	RefSeq	ILMN_213500	ILMN_224439	0610010K06RIK	NM_027861.2	NM_027861.2		71678	124244090	NM_027861.2	0610010K06Rik	NP_082137.1	ILMN_2637698	001500400	S	3168	GGCCATGTTCACGTGATCGCATGAGCAGTCTTGTTGATTGTAAAGCTAAC	1|NT_165754.2	-	249928-249977		Mus musculus RIKEN cDNA 0610010K06 gene (0610010K06Rik), mRNA.	Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]				
0610010K06RIK	1570091	52.1	1	NaN	1.854	78	0.20513	47.9	1	NaN	1.335	62	0.24038	46.3	1	NaN	1.355	49	0.24038	47.0	1	NaN	1.633	59	0.16560	45.8	1	NaN	1.272	65	0.20727	40.0	1	NaN	1.323	44	0.48184	Mus musculus	Riken	ILMN_201958	ILMN_201958	0610010K06RIK	ri|0610010K06|R000002I04|AK002489|817					AK002489	0610010K06Rik		ILMN_1243274	001570091	S	499	GAAGGAAGGAAGCCGAGGACCACTGTGAGAGAACGTAGGCCTGATGCGTG						Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]				
0610010K14RIK	2690324	1215.4	1	NaN	36.904	41	0.00000	560.8	1	NaN	20.618	32	0.00000	79.8	1	NaN	2.705	37	0.00000	85.2	1	NaN	2.978	48	0.00000	87.3	1	NaN	2.867	48	0.00000	75.3	1	NaN	2.628	39	0.00000	Mus musculus	RefSeq	ILMN_216704	ILMN_216704	0610010K14RIK	NM_026757.1	NM_026757.1		104457	21389317	NM_026757.1	0610010K14Rik	NP_081033.1	ILMN_2674228	002690324	S	318	ATGACGTCCGGTGTCCTCTCACCTCCAAACGCCCCTCCACCCAGCAGCTC	11	-	70051096-70051106:70051033-70051071	11qB3	Mus musculus RIKEN cDNA 0610010K14 gene (0610010K14Rik), mRNA.	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]		Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]	AL033328; RP23-198E14.7; AU045833; 1110020A23Rik	
0610011B16RIK	5270551	51.1	1	NaN	2.852	55	0.24359	40.9	1	NaN	1.433	51	0.86218	37.8	1	NaN	1.582	45	0.93269	40.2	1	NaN	1.519	49	0.75748	39.2	1	NaN	1.903	32	0.82372	39.5	1	NaN	1.569	51	0.52244	Mus musculus	RefSeq	ILMN_207498	ILMN_207498	0610011B16RIK	XM_148460.1	XM_148460.1			20891600	XM_148460.1	0610011B16Rik		ILMN_1260494	005270551	I	1	AGGCAGGCCGCAGGAGCTTCCGATTGGTTGTCATCAATAAGGGCGTGGCA										
0610011F06RIK	2230674	426.0	1	NaN	14.429	60	0.00000	197.1	1	NaN	7.459	51	0.00000	133.3	1	NaN	5.272	52	0.00000	118.6	1	NaN	3.298	56	0.00000	159.5	1	NaN	5.117	48	0.00000	108.2	1	NaN	4.750	49	0.00000	Mus musculus	RefSeq	ILMN_186795	ILMN_257036	0610011F06RIK	NM_026686.1	NM_026686.1		68347	58037114	NM_026686.1	0610011F06Rik	NP_080962.1	ILMN_2438555	002230674	S	239	TTGTCCAATGTGAAGGCTCCGCTGTACCTGGACGTGACCTGGGAGTGGGA	17	+	26012933-26012982	17qA3.3	Mus musculus RIKEN cDNA 0610011F06 gene (0610011F06Rik), mRNA.					
0610011I19RIK	5910240	481.3	1	NaN	15.392	54	0.00000	194.5	1	NaN	5.938	47	0.00000	54.2	1	NaN	2.269	51	0.02350	51.0	1	NaN	1.722	50	0.03632	60.7	1	NaN	2.144	62	0.00321	47.9	1	NaN	1.933	44	0.03098	Mus musculus	Riken	ILMN_201956	ILMN_201956	0610011I19RIK	ri|0610011I19|R000002D04|AK002548|1137					AK002548	0610011I19Rik		ILMN_2545915	005910240	S	983	AGCAGTAGCAAGAACAGCATCCAAGCTAGCCACATCATCACCCGTGCCCC										
0610011L14RIK	1710201	61.0	1	NaN	3.110	36	0.04487	50.3	1	NaN	2.246	47	0.15278	43.8	1	NaN	1.288	43	0.45299	44.3	1	NaN	2.400	27	0.36004	40.8	1	NaN	1.778	34	0.66132	42.5	1	NaN	1.793	31	0.24679	Mus musculus	RefSeq	ILMN_210035	ILMN_210035	0610011L14RIK	NM_026661.3	NM_026661.3		68295	142365065	NM_026661.3	0610011L14Rik	NP_080937.2	ILMN_2601546	001710201	S	3229	CATTCACTAACAGACTGTGTTGGGGTTAGGAGGCCACACGACATGCAGGC	2	+	156394513-156394562	2qH1	Mus musculus RIKEN cDNA 0610011L14 gene (0610011L14Rik), mRNA.			Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [evidence IPI]		
0610012A05RIK	6900731	51.5	1	NaN	2.216	34	0.22756	43.2	1	NaN	1.870	33	0.63462	40.3	1	NaN	2.120	38	0.79915	35.9	1	NaN	1.783	29	0.97543	38.5	1	NaN	1.856	32	0.86752	35.3	1	NaN	2.126	29	0.91346	Mus musculus	MEEBO	ILMN_189615	ILMN_189615	0610012A05RIK	scl47331.6_185				21539602	NM_026153	0610012A05Rik		ILMN_1230831	006900731	S	1	AAGGAAGTTATAGGTGAGAGGCTTGTGGAGAGGGGCTAACTCCAGTCCCC										
0610012D14RIK	360544	70.8	1	NaN	3.354	36	0.00962	52.7	1	NaN	1.943	33	0.09722	39.9	1	NaN	2.016	30	0.83547	43.8	1	NaN	2.428	29	0.41239	43.8	1	NaN	1.912	39	0.36538	40.9	1	NaN	1.793	43	0.39637	Mus musculus	RefSeq	ILMN_213393	ILMN_213393	0610012D14RIK	NM_026690.1	NM_026690.1		68352	21312001	NM_026690.1	0610012D14Rik	NP_080966.1	ILMN_2848071	000360544	S	652	CCCCAGTCTAGGCTTCGACCGTGTCATTGGGGTGCTTGTGGCTGACCTTA	7	+	51722425-51722474	7qB4	Mus musculus RIKEN cDNA 0610012D14 gene (0610012D14Rik), mRNA.		The process of removal or addition of one or more electrons with or without the concomitant removal or addition of a proton or protons [goid 55114] [evidence IEA]; The chemical reactions and pathways resulting in the formation of a pyridine nucleotide, a nucleotide characterized by a pyridine derivative as a nitrogen base [goid 19363] [evidence IEA]; The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]; The chemical reactions and pathways resulting in the breakdown of nicotinamide-adenine dinucleotide phosphate, a coenzyme involved in many redox and biosynthetic reactions; catabolism may be of either the oxidized form, NADP, or the reduced form, NADPH [goid 6742] [evidence IEA]	Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced [goid 16491] [evidence IEA]; Catalysis of the reaction: L-aspartate + H2O + NAD(P)+ = oxaloacetate + NH3 + NAD(P)H + H+ [goid 33735] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]; The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA]		
0610012D14RIK	3190202	78.2	1	NaN	3.186	36	0.00534	60.0	1	NaN	1.875	45	0.03098	41.1	1	NaN	1.806	42	0.72436	41.6	1	NaN	1.650	40	0.61859	38.1	1	NaN	1.512	42	0.88462	39.5	1	NaN	1.673	52	0.52244	Mus musculus	RefSeq	ILMN_213393	ILMN_213393	0610012D14RIK	NM_026690.1	NM_026690.1		68352	21312001	NM_026690.1	0610012D14Rik	NP_080966.1	ILMN_1248518	003190202	S	896	TGCTGAGTCTCCTCCCCTACTACCCTTACTGTCATATTGACAACTATGGG	7	+	51723051-51723056:51723057-51723100	7qB4	Mus musculus RIKEN cDNA 0610012D14 gene (0610012D14Rik), mRNA.		The process of removal or addition of one or more electrons with or without the concomitant removal or addition of a proton or protons [goid 55114] [evidence IEA]; The chemical reactions and pathways resulting in the formation of a pyridine nucleotide, a nucleotide characterized by a pyridine derivative as a nitrogen base [goid 19363] [evidence IEA]; The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]; The chemical reactions and pathways resulting in the breakdown of nicotinamide-adenine dinucleotide phosphate, a coenzyme involved in many redox and biosynthetic reactions; catabolism may be of either the oxidized form, NADP, or the reduced form, NADPH [goid 6742] [evidence IEA]	Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced [goid 16491] [evidence IEA]; Catalysis of the reaction: L-aspartate + H2O + NAD(P)+ = oxaloacetate + NH3 + NAD(P)H + H+ [goid 33735] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]; The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA]		
0610012G03RIK	5700132	2632.8	1	NaN	90.765	60	0.00000	1227.2	1	NaN	42.763	32	0.00000	338.4	1	NaN	13.958	33	0.00000	299.4	1	NaN	11.621	41	0.00000	413.0	1	NaN	17.874	36	0.00000	276.8	1	NaN	13.333	34	0.00000	Mus musculus	MEEBO	ILMN_215367	ILMN_215367	0610012G03RIK	scl48561.1.13_8				13384687	NM_025320	0610012G03Rik		ILMN_2658619	005700132	S	636	ACTGGTGCAGGAGAATACCAGGGGAGCTTGTAAATGGAACGACAACCCCG						The part of a cell or its extracellular environment in which a gene product is located. A gene product may be located in one or more parts of a cell and its location may be as specific as a particular macromolecular complex, that is, a stable, persistent association of macromolecules that function together [goid 5575] [evidence ND ]	Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ]	Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [evidence IPI]		
0610012H03RIK	3460754	49.2	1	NaN	2.116	35	0.34509	39.2	1	NaN	1.614	37	0.94017	39.0	1	NaN	1.406	36	0.88782	40.9	1	NaN	1.893	42	0.69658	38.6	1	NaN	1.353	40	0.86752	39.7	1	NaN	1.752	33	0.50214	Mus musculus	RefSeq	ILMN_217412	ILMN_217412	0610012H03RIK	NM_028747.1	NM_028747.1		74088	21311852	NM_028747.1	0610012H03Rik	NP_083023.1	ILMN_2682917	003460754	S	1002	ACCCCTTTAAGAGAAGTGCACAGTGAGGTTTACAGACAGAAGCCATTCAC	2	+	105219423-105219472	2qE3	Mus musculus RIKEN cDNA 0610012H03 gene (0610012H03Rik), mRNA.	A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA]	Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ]	Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ]	RP23-444H3.1	
0610012H03RIK	4260014	113.0	1	NaN	4.806	39	0.00000	61.1	1	NaN	2.458	36	0.02991	46.1	1	NaN	1.489	43	0.25214	41.4	1	NaN	1.843	35	0.64423	40.5	1	NaN	2.111	31	0.70620	43.3	1	NaN	2.440	30	0.19017	Mus musculus	RefSeq	ILMN_217412	ILMN_217412	0610012H03RIK	NM_028747.1	NM_028747.1		74088	21311852	NM_028747.1	0610012H03Rik	NP_083023.1	ILMN_2972403	004260014	S	1438	GCTTCTCTGCCACATCCTTAGCCTATATTCATTACCTGTGTCATGGGTGG	2	+	105219859-105219908	2qE3	Mus musculus RIKEN cDNA 0610012H03 gene (0610012H03Rik), mRNA.	A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA]	Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ]	Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ]	RP23-444H3.1	
0610013E23RIK	5900646	54.0	1	NaN	3.240	24	0.13782	50.2	1	NaN	3.620	30	0.15491	36.1	1	NaN	1.221	41	0.97329	37.7	1	NaN	1.861	25	0.93162	41.0	1	NaN	1.617	33	0.64209	32.3	1	NaN	1.378	34	0.98611	Mus musculus	RefSeq	ILMN_214153	ILMN_214153	0610013E23RIK	NM_029788.2	NM_029788.2		76892	31541789	NM_029788.2	0610013E23Rik	NP_084064.1	ILMN_2973337	005900646	S	3831	TGAGGACTGGGAAGGGACTGAAGGCAGGCACCACCGCATGTGGCAAGATG	11	+	86314599-86314648	11qC	Mus musculus RIKEN cDNA 0610013E23 gene (0610013E23Rik), mRNA.				AV007605; RP23-467J12.1	
0610025G21RIK	430280	50.7	1	NaN	2.344	53	0.25748	45.0	1	NaN	1.824	41	0.48718	40.3	1	NaN	1.325	51	0.81090	41.8	1	NaN	1.388	60	0.59509	39.4	1	NaN	1.358	50	0.80449	38.2	1	NaN	1.525	50	0.66346	Mus musculus	Riken	ILMN_202405	ILMN_202405	0610025G21RIK	ri|0610025G21|R000004G05|AK002660|561					AK002660	0610025G21Rik		ILMN_2549368	000430280	S	245	TCTCAGATTAAAGGAGCCAGCCAGGACCGTGCAGAAGTACTCCCGAGGGG										
0610025J13RIK	1980110	51.0	1	NaN	1.888	62	0.24573	43.9	1	NaN	1.666	58	0.58654	43.7	1	NaN	1.478	74	0.46795	47.3	1	NaN	1.913	48	0.14637	40.6	1	NaN	1.590	60	0.69444	41.0	1	NaN	1.389	68	0.38675	Mus musculus	MEEBO	ILMN_184441	ILMN_184441	0610025J13RIK	scl25258.6.1_0				51709792	XM_355548	0610025J13Rik		ILMN_2418656	001980110	S	16	CGCCACCTACCGGCGACCAGGCAAGCGTCAGTGCGACCCCAAAGCAAGCT										
0610025J13RIK	4890184	52.7	1	NaN	2.133	58	0.17521	48.5	1	NaN	2.050	50	0.21368	49.8	1	NaN	2.080	43	0.07479	42.7	1	NaN	1.378	49	0.50214	44.0	1	NaN	1.567	47	0.34936	41.5	1	NaN	1.486	57	0.34615	Mus musculus	MEEBO	ILMN_184441	ILMN_184441	0610025J13RIK	scl25258.6.1_0				51709792	XM_355548	0610025J13Rik		ILMN_1236032	004890184	S	19	CACCTACCGGCGACCAGGCAAGCGTCAGTGCGACCCCAAAGCAAGCTGCT										
0610025P10RIK	6270482	250.9	1	NaN	7.084	39	0.00000	154.9	1	NaN	5.116	28	0.00000	58.4	1	NaN	2.067	37	0.00534	61.0	1	NaN	1.951	42	0.00214	60.9	1	NaN	2.268	37	0.00321	54.4	1	NaN	2.466	34	0.00427	Mus musculus	RefSeq	ILMN_211309	ILMN_235057	0610025P10RIK	NM_001013414.1	NM_001013414.1		216860	61740636	NM_001013414.1	0610025P10Rik	NP_001013432.1	ILMN_1226653	006270482	S	4935	GCACTGACTTGGGGAACATGACTCCCTATTATTACCCTCCCCCATATCAC	11	+	69721413-69721462	11qB3	Mus musculus RIKEN cDNA 0610025P10 gene (0610025P10Rik), mRNA.				BC023037; RP23-172M21.17; KIAA1787	
0610030E20RIK	2100092	160.7	1	NaN	6.321	55	0.00000	100.0	1	NaN	4.764	55	0.00000	49.8	1	NaN	1.513	49	0.07479	48.4	1	NaN	2.440	47	0.10256	53.3	1	NaN	1.841	43	0.02564	41.7	1	NaN	1.355	58	0.33013	Mus musculus	RefSeq	ILMN_208862	ILMN_231632	0610030E20RIK	XM_910556.2	XM_910556.2		68364	94377644	XM_910556.2	0610030E20Rik	XP_915649.1	ILMN_2655105	002100092	S	1190	TGAGGTCGTTTGTCAGGCCCCTTCATGTTTCTGCTTTCTTCCACTCATCT				6qC1	PREDICTED: Mus musculus RIKEN cDNA 0610030E20 gene, transcript variant 6 (0610030E20Rik), mRNA.					
0610030E20RIK	2190551	125.5	1	NaN	4.401	51	0.00000	84.4	1	NaN	2.192	49	0.00000	46.8	1	NaN	1.888	56	0.20833	42.1	1	NaN	1.575	66	0.57051	40.2	1	NaN	1.667	37	0.73184	37.8	1	NaN	1.791	39	0.70299	Mus musculus	RefSeq	ILMN_201793	ILMN_231920	0610030E20RIK	XM_921694.2	XM_921694.2		68364	94377646	XM_921694.2	0610030E20Rik	XP_926787.1	ILMN_2544634	002190551	S	839	TAAGGTAGCTGGGACCCGGCCAGGAAACGCTGTCCACCAGTGTGATCTAT				6qC1	PREDICTED: Mus musculus RIKEN cDNA 0610030E20 gene, transcript variant 9 (0610030E20Rik), mRNA.					
0610030E20RIK	6280719	49.9	1	NaN	2.729	42	0.29915	46.5	1	NaN	1.748	49	0.33547	41.2	1	NaN	1.354	62	0.71047	39.7	1	NaN	1.542	48	0.78846	44.5	1	NaN	1.989	42	0.30342	42.6	1	NaN	1.701	43	0.23932	Mus musculus	RefSeq	ILMN_208862	ILMN_231632	0610030E20RIK	XM_910556.2	XM_910556.2		68364	94377644	XM_910556.2	0610030E20Rik	XP_915649.1	ILMN_2653890	006280719	S	2893	GGTCGGGACAAAGAACATTGGAACTTTTTGGGGGTCTGTGTTCTTAGAGC				6qC1	PREDICTED: Mus musculus RIKEN cDNA 0610030E20 gene, transcript variant 6 (0610030E20Rik), mRNA.					
0610030E20RIK	6510338	551.7	1	NaN	18.521	46	0.00000	200.3	1	NaN	7.718	30	0.00000	49.2	1	NaN	1.969	44	0.08868	43.7	1	NaN	2.074	40	0.41667	55.6	1	NaN	2.180	49	0.01389	46.6	1	NaN	2.132	48	0.05876	Mus musculus	RefSeq	ILMN_208862	ILMN_231632	0610030E20RIK	XM_910556.2	XM_910556.2		68364	94377644	XM_910556.2	0610030E20Rik	XP_915649.1	ILMN_1220374	006510338	S	4598	CCTAGTTAGGGGTTCCTCCTTTCCCAGAGCAAACAGAACAAGAGGTTGGG				6qC1	PREDICTED: Mus musculus RIKEN cDNA 0610030E20 gene, transcript variant 6 (0610030E20Rik), mRNA.					
0610030G03RIK	1340356	62.3	1	NaN	3.706	46	0.03846	50.1	1	NaN	2.848	42	0.15919	36.5	1	NaN	1.495	47	0.96688	40.3	1	NaN	2.117	44	0.74786	39.5	1	NaN	1.932	38	0.79915	38.3	1	NaN	1.689	37	0.65064	Mus musculus	Riken	ILMN_201610	ILMN_201610	0610030G03RIK	ri|0610030G03|R000004K23|AK002703|711					AK002703	0610030G03Rik		ILMN_1253221	001340356	S	510	TGGAGCCAGGGAGGGAGGCCATCTTAACCCAGCAGCGTCTGACTTCTAAG										
0610030P10RIK	5260669	218.0	1	NaN	8.514	53	0.00000	100.4	1	NaN	3.501	55	0.00000	41.1	1	NaN	1.295	53	0.72329	41.4	1	NaN	1.614	48	0.64316	40.6	1	NaN	1.677	49	0.68376	39.1	1	NaN	1.531	47	0.56410	Mus musculus	Riken	ILMN_201612	ILMN_201612	0610030P10RIK	ri|0610030P10|R000004M19|AK002715|815					AK002715	0610030P10Rik		ILMN_2543198	005260669	S	631	CAAGGAGGATCGATGTTACAGAGATAAGATCCAGAGTGCCCGCTGCCTGG										
0610031G08RIK	2070347	99.6	1	NaN	3.774	55	0.00000	65.3	1	NaN	3.086	38	0.01282	90.4	1	NaN	4.408	44	0.00000	104.7	1	NaN	3.277	49	0.00000	129.5	1	NaN	4.373	60	0.00000	93.4	1	NaN	3.507	59	0.00000	Mus musculus	MEEBO	ILMN_187514	ILMN_187514	0610031G08RIK	scl075393.1_11						0610031G08Rik		ILMN_2444799	002070347	S	19	GGAAGACCAGAGAGTTGCCTCGACGTTGTTCACCTAAATCCGTGGCGGGC										
0610031J06RIK	540041	192.6	1	NaN	10.634	24	0.00000	104.2	1	NaN	6.747	21	0.00000	54.8	1	NaN	2.939	30	0.01816	49.7	1	NaN	2.689	32	0.06197	50.0	1	NaN	1.720	40	0.04915	41.3	1	NaN	2.045	38	0.36004	Mus musculus	RefSeq	ILMN_212580	ILMN_212580	0610031J06RIK	NM_020003.1	NM_020003.1		56700	9910457	NM_020003.1	0610031J06Rik	NP_064387.1	ILMN_2727437	000540041	S	1031	GAACAACTTCTGTGCCTTCAATCTGACCTTTGGGGCTCCCACGGGCCCTG	3	+	88131958-88132007	3qF1	Mus musculus RIKEN cDNA 0610031J06 gene (0610031J06Rik), mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]			AB027141; NCU-G1	
0610031J06RIK	3800215	824.8	1	NaN	21.932	37	0.00000	490.9	1	NaN	14.708	49	0.00000	109.8	1	NaN	4.860	48	0.00000	93.1	1	NaN	3.456	45	0.00000	115.7	1	NaN	3.749	45	0.00000	86.4	1	NaN	2.641	44	0.00000	Mus musculus	RefSeq	ILMN_212580	ILMN_212580	0610031J06RIK	NM_020003.1	NM_020003.1		56700	9910457	NM_020003.1	0610031J06Rik	NP_064387.1	ILMN_2628021	003800215	S	1350	CTGCAGAACCTCAGAAGCCAGCCTCAACCTACTGGGGTGCTCCCAGTAAG	3	+	88132366-88132415	3qF1	Mus musculus RIKEN cDNA 0610031J06 gene (0610031J06Rik), mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]			AB027141; NCU-G1	
0610031J06RIK	5810243	655.1	1	NaN	22.991	54	0.00000	310.7	1	NaN	10.261	38	0.00000	81.6	1	NaN	3.286	43	0.00000	76.4	1	NaN	3.191	40	0.00000	102.6	1	NaN	4.306	34	0.00000	69.9	1	NaN	2.625	40	0.00000	Mus musculus	RefSeq	ILMN_212580	ILMN_212580	0610031J06RIK	NM_020003.1	NM_020003.1		56700	9910457	NM_020003.1	0610031J06Rik	NP_064387.1	ILMN_2793281	005810243	S	1259	CCAGTCCATAAACTGAAACCCACTCTCCAGAGGGAAGGGCAGTGTCTCAG	3	+	88132275-88132290:88132291-88132324	3qF1	Mus musculus RIKEN cDNA 0610031J06 gene (0610031J06Rik), mRNA.	Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]			AB027141; NCU-G1	
0610033M06RIK	3400750	49.2	1	NaN	3.522	41	0.35150	37.1	1	NaN	1.751	49	0.98504	37.7	1	NaN	1.860	41	0.93697	37.4	1	NaN	1.432	33	0.94017	36.4	1	NaN	1.520	41	0.95940	31.8	1	NaN	1.205	56	0.99038	Mus musculus	Riken	ILMN_207261	ILMN_207261	0610033M06RIK	ri|G630005K04|PL00012N06|AK090146|2714					AK090146	0610033M06Rik		ILMN_1253176	003400750	S	2530	AAGAGTTGTAATCGGCAGGGAGGCAGTGGGAAGGGCAGAAGGGACTGAGG										
0610035N01RIK	6060528	51.3	1	NaN	2.139	42	0.23611	41.6	1	NaN	1.742	50	0.80128	42.3	1	NaN	1.781	43	0.60150	42.2	1	NaN	2.034	47	0.55235	37.3	1	NaN	1.519	42	0.92308	36.1	1	NaN	1.336	38	0.85043	Mus musculus	Riken	ILMN_203527	ILMN_203527	0610035N01RIK	ri|5330402M06|PX00053E21|AK030365|4168					AK030365	0610035N01Rik		ILMN_1228112	006060528	S	3984	TGGTCCATCGGGAGCCATGAAGTTGGTTACTGGCCTGGGGTTCTTCTCTG										
0610037B23RIK	1980367	50.3	1	NaN	1.719	86	0.26923	52.2	1	NaN	1.542	66	0.10791	45.0	1	NaN	1.734	55	0.33333	45.7	1	NaN	1.538	62	0.24359	45.2	1	NaN	1.363	54	0.25321	43.5	1	NaN	1.529	52	0.17415	Mus musculus	Riken	ILMN_201604	ILMN_201604	0610037B23RIK	ri|0610037B23|R000004B17|AK002767|743					AK002767	0610037B23Rik		ILMN_1248172	001980367	S	546	CTCTGGTCAACTCTGCTCGCTCAGTACCTGCTCACTCTGGCCCAAGGATT										
0610037D15RIK	5270753	190.7	1	NaN	8.409	39	0.00000	101.5	1	NaN	4.737	41	0.00000	48.8	1	NaN	1.873	46	0.10256	44.7	1	NaN	1.365	37	0.33227	48.4	1	NaN	2.074	46	0.09081	47.2	1	NaN	1.738	50	0.04487	Mus musculus	RefSeq	ILMN_216272	ILMN_216272	0610037D15RIK	NM_026714.2	NM_026714.2		68394	134053899	NM_026714.2	0610037D15Rik	NP_080990.2	ILMN_1234456	005270753	S	813	GGACAGGGTTCATACCTTGGAGGTTTCCAGTACAGAGGCCCATGATGCCC	4	+	116385357-116385406	4qD1	Mus musculus RIKEN cDNA 0610037D15 gene (0610037D15Rik), mRNA.				4933430J04Rik	
0610037L13RIK	2070564	1070.0	1	NaN	32.493	38	0.00000	594.0	1	NaN	25.894	25	0.00000	167.7	1	NaN	3.918	37	0.00000	159.8	1	NaN	5.892	38	0.00000	199.8	1	NaN	8.123	33	0.00000	125.9	1	NaN	3.553	46	0.00000	Mus musculus	RefSeq	ILMN_210991	ILMN_210991	0610037L13RIK	NM_028754.2	NM_028754.2		74098	118130504	NM_028754.2	0610037L13Rik	NP_083030.1	ILMN_2611352	002070564	S	1457	GTTGTGCCTTCATACCTGGGAAACCTGTTTCCACACACTATTTCTCCAAT	4	+	107570313-107570362	4qC7	Mus musculus RIKEN cDNA 0610037L13 gene (0610037L13Rik), mRNA.	The part of a cell or its extracellular environment in which a gene product is located. A gene product may be located in one or more parts of a cell and its location may be as specific as a particular macromolecular complex, that is, a stable, persistent association of macromolecules that function together [goid 5575] [evidence ND ]	Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ]	Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ]	1110008H16Rik; RP23-40G2.3	
0610037L13RIK	3840519	634.6	1	NaN	33.437	30	0.00000	298.8	1	NaN	9.828	41	0.00000	96.6	1	NaN	4.014	43	0.00000	89.4	1	NaN	3.318	44	0.00000	127.0	1	NaN	6.274	31	0.00000	98.4	1	NaN	4.336	37	0.00000	Mus musculus	MEEBO	ILMN_210991	ILMN_210991	0610037L13RIK	scl074098.7_10	NM_028754.1			21539638	NM_028754.1	0610037L13Rik		ILMN_2622630	003840519	S	221	AAATCGCACTGCAGCTCAAAGCCACGCTGGAGAACGTCACGAACCTTCGG						The part of a cell or its extracellular environment in which a gene product is located. A gene product may be located in one or more parts of a cell and its location may be as specific as a particular macromolecular complex, that is, a stable, persistent association of macromolecules that function together [goid 5575] [evidence ND ]	Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ]	Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ]		
0610037M15RIK	5820128	132.3	1	NaN	4.676	62	0.00000	72.2	1	NaN	3.492	53	0.00321	51.3	1	NaN	1.656	57	0.05021	49.4	1	NaN	1.371	64	0.07585	50.6	1	NaN	1.713	38	0.04274	43.4	1	NaN	1.459	72	0.18483	Mus musculus	MEEBO	ILMN_193252	ILMN_193252	0610037M15RIK	scl0068395.1_77						0610037M15Rik		ILMN_2495446	005820128	S	5	GACCGCACAGAGATACTACAACCAGAGCAAGGGCGGCTCTCACACACTCC										
0610037P05RIK	6480132	70.5	1	NaN	4.457	41	0.00962	49.2	1	NaN	2.231	54	0.18483	44.3	1	NaN	1.402	58	0.39316	42.7	1	NaN	1.223	54	0.50962	40.2	1	NaN	1.530	46	0.73184	36.7	1	NaN	1.308	59	0.81090	Mus musculus	RefSeq	ILMN_211262	ILMN_227024	0610037P05RIK	NM_025345.2	NM_025345.2		66086	31560259	NM_025345.2	0610037P05Rik	NP_079621.1	ILMN_1230077	006480132	S	258	CCATTGGACAGACAGTTTCTCATCCGTGAACTAAATGCCTTTGAAGAATC	16	-	14311154-14311203	16qA1	Mus musculus RIKEN cDNA 0610037P05 gene (0610037P05Rik), mRNA.					
0610037P05RIK	6860170	42.5	1	NaN	2.165	30	0.86432	40.6	1	NaN	1.527	42	0.87073	41.0	1	NaN	2.138	27	0.74145	41.2	1	NaN	1.775	33	0.66774	40.7	1	NaN	1.661	40	0.67735	33.6	1	NaN	1.248	27	0.97329	Mus musculus	RefSeq	ILMN_211262	ILMN_227024	0610037P05RIK	NM_025345.2	NM_025345.2		66086	31560259	NM_025345.2	0610037P05Rik	NP_079621.1	ILMN_2717539	006860170	S	999	TTGAAAAAATATCTAAAGGAATATTAAAACCAGAACTTAATTTATATGAA	16	-	14299710-14299759	16qA1	Mus musculus RIKEN cDNA 0610037P05 gene (0610037P05Rik), mRNA.					
0610038B21RIK	3130332	73.0	1	NaN	2.087	54	0.00748	48.6	1	NaN	1.782	49	0.20940	39.4	1	NaN	1.146	52	0.87500	37.0	1	NaN	1.469	54	0.94872	41.4	1	NaN	1.262	59	0.60363	35.8	1	NaN	1.012	56	0.87393	Mus musculus	MEEBO	ILMN_186207	ILMN_186207	0610038B21RIK	scl070345.3_145						0610038B21Rik		ILMN_1246762	003130332	S	7	CATTTTATCTGTGTACCGAAGGAAGGGTGCTTCGCTGTGCAAGGGCTCGC										
0610038D11RIK	6760408	149.0	1	NaN	4.733	58	0.00000	99.3	1	NaN	3.298	50	0.00000	54.0	1	NaN	1.886	62	0.02350	52.3	1	NaN	1.487	54	0.02671	52.7	1	NaN	1.869	56	0.02885	49.4	1	NaN	1.658	57	0.02137	Mus musculus	RefSeq	ILMN_190490	ILMN_233182	0610038D11RIK	NM_026306.2	NM_026306.2		67674	61098119	NM_026306.2	0610038D11Rik	NP_080582.2	ILMN_2470615	006760408	S	237	TCCGATCTCGGCTGCCGCCAAGCCCCCCAAAAGGTCCCCTAAGTCGGCCA	19	+	6984522-6984571	19qA	Mus musculus RIKEN cDNA 0610038D11 gene (0610038D11Rik), mRNA.					
0610038F07RIK	3990307	464.4	1	NaN	13.730	51	0.00000	199.1	1	NaN	7.144	50	0.00000	74.9	1	NaN	2.334	48	0.00000	78.3	1	NaN	2.919	51	0.00000	88.3	1	NaN	2.166	53	0.00000	63.4	1	NaN	2.196	43	0.00000	Mus musculus	RefSeq	ILMN_209464	ILMN_209464	0610038F07RIK	NM_025333.3	NM_025333.3		66072	53828928	NM_025333.3	0610038F07Rik	NP_079609.2	ILMN_2596016	003990307	S	1672	CGCTCCCACAGACAAATAGCATTGGGCCTACTTAAGGACAAGAGATTGCC	19	-	10576377-10576426	19qA	Mus musculus RIKEN cDNA 0610038F07 gene (0610038F07Rik), mRNA.	A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IEA]	Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ]	Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ]	AA407634; AW049997; MGC61338	
0610038F15RIK	4250086	54.7	1	NaN	2.096	50	0.11325	49.6	1	NaN	1.983	42	0.17628	49.6	1	NaN	1.327	60	0.07906	47.6	1	NaN	2.043	40	0.13248	43.9	1	NaN	1.239	64	0.35684	43.7	1	NaN	1.753	51	0.16453	Mus musculus	Riken	ILMN_201606	ILMN_201606	0610038F15RIK	ri|0610038F15|R000004H07|AK002794|638					AK002794	0610038F15Rik		ILMN_2543157	004250086	S	343	TGAGGACACTTTGCAGGAGACGGAGATTTAGATAACCCGTGTGGGTGCCC										
0610039K10RIK	5340379	48.1	1	NaN	1.909	62	0.42521	40.6	1	NaN	1.527	56	0.87393	39.6	1	NaN	1.228	73	0.86004	36.6	1	NaN	1.133	54	0.96154	37.2	1	NaN	1.289	62	0.93056	36.2	1	NaN	1.236	65	0.84081	Mus musculus	MEEBO	ILMN_186331	ILMN_186331	0610039K10RIK	scl19955.1.2_15						0610039K10Rik		ILMN_2434621	005340379	S	2	GAGAGATGGAATGTTGGCAAACTCAGAGGCAAACAGGCTATGTTGGGCCA										
0610040B10RIK	7330743	133.5	1	NaN	5.118	42	0.00000	82.7	1	NaN	3.128	43	0.00000	47.3	1	NaN	2.230	43	0.16774	39.4	1	NaN	1.355	31	0.80556	50.6	1	NaN	2.124	40	0.04380	41.4	1	NaN	1.287	32	0.35897	Mus musculus	RefSeq	ILMN_215673	ILMN_319139	0610040B10RIK	XM_001479510.1	XM_001479510.1		67672	149254466	XM_001479510.1	0610040B10Rik	XP_001479560.1	ILMN_1242334	007330743	S	502	CCATGATCCCTTGTCCCTGGGAGGACTGTCTGAGACATTAGAGAAATGGG					PREDICTED: Mus musculus RIKEN cDNA 0610040B10 gene (0610040B10Rik), mRNA.					
0610040J01RIK	4920632	83.1	1	NaN	2.980	44	0.00107	66.2	1	NaN	2.989	36	0.01068	40.3	1	NaN	1.555	41	0.81197	42.0	1	NaN	1.578	53	0.57265	42.1	1	NaN	1.965	24	0.52671	41.0	1	NaN	1.799	29	0.39316	Mus musculus	RefSeq	ILMN_209810	ILMN_209810	0610040J01RIK	NM_029554.2	NM_029554.2		76261	31981328	NM_029554.2	0610040J01Rik	NP_083830.2	ILMN_2915716	004920632	S	1564	GCCCGGACATCCCCACTCTTGATCCCAGGGGCCATTCTGTTTGAATGTAT	5	+	64178317-64178366	5qC3.1	Mus musculus RIKEN cDNA 0610040J01 gene (0610040J01Rik), mRNA.				AI662686	
0610040O15RIK	940634	32153.0	1	NaN	638.670	39	0.00000	18665.4	1	NaN	488.091	45	0.00000	4204.8	1	NaN	113.866	59	0.00000	4115.0	1	NaN	118.560	47	0.00000	5468.4	1	NaN	122.922	44	0.00000	2763.2	1	NaN	69.494	58	0.00000	Mus musculus	Riken	ILMN_202712	ILMN_202712	0610040O15RIK	ri|0610040O15|R000004D20|AK018753|84					AK018753	0610040O15Rik		ILMN_1240829	000940634	S	1	GTAGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACAC										


More information about the Bioconductor mailing list