[BioC] BLAST - annotate package?

[James W. MacDonald]

Hi Tim,

Try changing the hitListSize to character:

 > blastSequences(x = 
"CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize="2")
[[1]]
DNAMultipleAlignment with 2 rows and 36 columns
      aln
[1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT
[2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT

[[2]]
DNAMultipleAlignment with 2 rows and 36 columns
      aln
[1] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT
[2] CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT


Best,

Jim



On 8/31/2012 2:44 PM, Tim Smith wrote:
> Hi,
>
> Sorry for this basic question - I'm new to BLAST!
>
> I am trying to do BLAST (dna-nucleotide) for a sequence. I want to a sequence with the rhesus organism. I would like to get the following values:
>
> 1. Score (bits)
> 2. E-value
> 3. # Matches
>
>
> I am trying to use the 'annotate' package with the following code:
>
> library(annotate)
> xx<- blastSequences(x = "CAGTTTCTTGAGTCTGATTAATTCAGGTTTCGGGGT",hitListSize=2,program = "blastn")
>
>
> Can (how?) I get the values that I want from the object returned? If not, which package/function should I be using? Also, is there a website where I can get the abbreviations for the databases (e.g. is rhesus = 'rh'?)?
>
> Any pointers in the right direction would be highly appreciated
>
>
> many thanks
> 	[[alternative HTML version deleted]]
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor

-- 
James W. MacDonald, M.S.
Biostatistician
University of Washington
Environmental and Occupational Health Sciences
4225 Roosevelt Way NE, # 100
Seattle WA 98105-6099