[BioC] Fwd: ASSIST on contrast matrix

[Seyed Ahmad Mousavi]

>
>
> Hello
>
> I'm very eager to use Limma package for analyzing my Illumina microarray
> data,
> but i faced with problem in contrast matrix,i have 12 sample with below
> names in four group as you see:
>
> MR-VI-R1, MR-VI-R2, MR-VI-R3,
> MR-IX-R1, MR-IX-R2, MR-IX-R3,
> MR-XII-R1, MR-XII-R2, MR-XII-R3
> MR-XV-R1, MR-XV-R2, MR-XV-R3
>
> and i want to cluster them into four group named :
> "Six","Nine","Twelve","**Fifteen". But because of Illumina raw file i
> could
> not use
> targets<- readTarget()
> and another error on model.matrix().
>
> Therefore, How can i create contrast matrix?
> And you can find ten rows of my file in attachment.
>
> I appreciated for your reply.
> bests,
>
>
>
> --
Seyed Ahmad Mousavi
-------------- next part --------------
PROBE_ID	SYMBOL	MR-VI-R1.AVG_Signal	MR-VI-R1.Detection Pval	MR-VI-R1.BEAD_STDERR	MR-VI-R1.Avg_NBEADS	MR-VI-R2.AVG_Signal	MR-VI-R2.Detection Pval	MR-VI-R2.BEAD_STDERR	MR-VI-R2.Avg_NBEADS	MR-VI-R3.AVG_Signal	MR-VI-R3.Detection Pval	MR-VI-R3.BEAD_STDERR	MR-VI-R3.Avg_NBEADS	MR-IX-R1.AVG_Signal	MR-IX-R1.Detection Pval	MR-IX-R1.BEAD_STDERR	MR-IX-R1.Avg_NBEADS	MR-IX-R2.AVG_Signal	MR-IX-R2.Detection Pval	MR-IX-R2.BEAD_STDERR	MR-IX-R2.Avg_NBEADS	MR-IX-R3.AVG_Signal	MR-IX-R3.Detection Pval	MR-IX-R3.BEAD_STDERR	MR-IX-R3.Avg_NBEADS	MR-XII-R1.AVG_Signal	MR-XII-R1.Detection Pval	MR-XII-R1.BEAD_STDERR	MR-XII-R1.Avg_NBEADS	MR-XII-R2.AVG_Signal	MR-XII-R2.Detection Pval	MR-XII-R2.BEAD_STDERR	MR-XII-R2.Avg_NBEADS	MR-XII-R3.AVG_Signal	MR-XII-R3.Detection Pval	MR-XII-R3.BEAD_STDERR	MR-XII-R3.Avg_NBEADS	MR-XV-R1.AVG_Signal	MR-XV-R1.Detection Pval	MR-XV-R1.BEAD_STDERR	MR-XV-R1.Avg_NBEADS	MR-XV-R2.AVG_Signal	MR-XV-R2.Detection Pval	MR-XV-R2.BEAD_STDERR	MR-XV-R2.Avg_NBEADS	MR-XV-R3.AVG_Signal	MR-XV-R3.Detection Pval	MR-XV-R3.BEAD_STDERR	MR-XV-R3.Avg_NBEADS	SEARCH_KEY	ILMN_GENE	CHROMOSOME	DEFINITION	SYNONYMS	TargetID	ProbeID	SPECIES	SOURCE	TRANSCRIPT	SOURCE_REFERENCE_ID	REFSEQ_ID	UNIGENE_ID	ENTREZ_GENE_ID	GI	ACCESSION	PROTEIN_PRODUCT	ARRAY_ADDRESS_ID	PROBE_TYPE	PROBE_START	PROBE_SEQUENCE	PROBE_CHR_ORIENTATION	PROBE_COORDINATES	CYTOBAND	ONTOLOGY_COMPONENT	ONTOLOGY_PROCESS	ONTOLOGY_FUNCTION	OBSOLETE_PROBE_ID
ILMN_1762337	7A5	68.12339	0.5909091	3.795977	22	81.03699	0.187013	6.871885	25	84.15965	0.2363636	5.430288	23	84.16862	0.312987	5.658892	21	85.88108	0.2701299	4.357348	24	86.96101	0.2012987	5.839043	19	86.12077	0.2818182	5.816843	19	87.9188	0.2519481	4.042889	28	81.01576	0.448052	4.123793	30	76.6422	0.5493507	3.354405	24	92.51734	0.151948	6.498237	22	89.08936	0.2064935	6.55511	19	NM_182762.2	7A5	7	"Homo sapiens putative binding protein 7a5 (7A5), mRNA."		7A5	6450255	Homo sapiens	RefSeq	ILMN_183371	NM_182762.2	NM_182762.2		346389	47271497	NM_182762.2	NP_877439.2	6450255	S	2725	GTGTTACAAGACCTTCAGTCAGCTTTGGACAGAATGAAAAACCCTGTGAC	-	20147187-20147236	7p15.3e				
ILMN_2055271	A1BG	109.9177	0.009090909	7.478013	29	91.11002	0.04805195	5.753882	22	106.9506	0.01168831	8.875629	13	105.8267	0.02857143	5.745769	27	129.1355	0	13.663	17	102.8462	0.02857143	7.67631	19	107.4112	0.01298701	6.032412	18	111.0584	0.01428571	5.395066	29	97.32375	0.08181818	5.351633	29	107.2164	0.01038961	6.678312	25	140.1994	0	18.09667	13	111.5074	0.01558442	8.496122	27	NM_130786.2	A1BG	19	"Homo sapiens alpha-1-B glycoprotein (A1BG), mRNA."	A1B; GAB; HYST2477; ABG; DKFZp686F0970	A1BG	2570615	Homo sapiens	RefSeq	ILMN_175569	NM_130786.2	NM_130786.2		1	21071029	NM_130786.2	NP_570602.2	2570615	S	3151	GGGATTACAGGGGTGAGCCACCACGCCCAGCCCCAGCTTAGTTTTTTAAA	-	63548541-63548590	19q13.43c	The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite [goid 5576] [pmid 3458201] [evidence IDA]	"Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ]"	"Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ]"	A1B; GAB; HYST2477; ABG; DKFZp686F0970
ILMN_1736007	A1BG	77.10277	0.2844156	4.946341	29	77.45616	0.2766234	5.402149	24	87.31492	0.1532468	4.586613	17	93.6731	0.1142857	7.38156	21	94.46102	0.1	4.092672	34	91.49857	0.125974	6.968928	26	93.10905	0.1246753	6.764782	19	87.26788	0.2636364	3.600378	18	103.0366	0.04285714	7.573762	24	78.27501	0.4922078	3.718789	18	97.10295	0.1025974	6.880208	26	91.07079	0.1688312	4.898323	30	NM_130786.2	A1BG	19	"Homo sapiens alpha-1-B glycoprotein (A1BG), mRNA."	A1B; GAB; HYST2477; ABG; DKFZp686F0970	A1BG	6370619	Homo sapiens	RefSeq	ILMN_18893	NM_130786.2	NM_130786.2		1	21071029	NM_130786.2	NP_570602.2	6370619	S	2512	GCAGAGCTGGACGCTGTGGAAATGGCTGGATTCCTCTGTGTTCTTTCCCA	-	63549180-63549229	19q13.43c	The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite [goid 5576] [pmid 3458201] [evidence IDA]	"Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end [goid 8150] [evidence ND ]"	"Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions [goid 3674] [evidence ND ]"	A1B; GAB; HYST2477; ABG; DKFZp686F0970
ILMN_2383229	A1CF	52.90083	0.9753247	3.545432	20	67.81781	0.6324675	4.712298	30	77.33617	0.474026	4.467803	24	86.87768	0.238961	6.220565	23	72.08341	0.7402598	2.987666	18	83.2159	0.312987	5.584767	27	68.96771	0.848052	4.886689	19	86.88812	0.2753247	5.355885	25	80.70195	0.4584416	4.922028	21	72.6222	0.7051948	3.763146	27	80.76499	0.4649351	5.262026	30	66.52165	0.8935065	4.160127	30	NM_138932.1	A1CF	10	"Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 2, mRNA."	ASP; MGC163391; APOBEC1CF; ACF65; ACF64; ACF; RP11-564C4.2	A1CF	2600039	Homo sapiens	RefSeq	ILMN_18532	NM_138932.1	NM_138932.1		29974	20357574	NM_138932.1	NP_620310.1	2600039	A	1826	TGCTGTCCCTAATGCAACTGCACCCGTGTCTGCAGCCCAGCTCAAGCAAG	-	52566586-52566635	10q11.23c	"A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]; All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [pmid 12881431] [evidence IDA]; The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Protein complex that mediates editing of the mRNA encoding apolipoprotein B; catalyzes the deamination of C to U (residue 6666 in the human mRNA). Contains a catalytic subunit, APOBEC-1, and other proteins (e.g. human ASP; rat ASP and KSRP) [goid 30895] [pmid 10781591] [evidence IDA]"	Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; Any process involved in maintaining the structure and integrity of a protein and preventing it from degradation or aggregation [goid 50821] [pmid 12881431] [evidence IDA]	"Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with double-stranded RNA [goid 3725] [pmid 11871661] [evidence IDA]; Interacting selectively with single-stranded RNA [goid 3727] [pmid 11871661] [evidence IDA]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 12896982] [evidence IPI]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 10669759] [evidence IPI]"	ASP; APOBEC1CF; ACF65; ACF64; RP11-564C4.2; MGC163391; ACF
ILMN_1806310	A1CF	72.56313	0.4025974	5.41346	22	73.24579	0.4077922	4.136171	19	88.98305	0.1298701	6.685389	17	98.15165	0.06623377	5.847287	17	80.35466	0.438961	6.995658	18	73.87639	0.6207792	3.638785	17	81.47204	0.4649351	4.067728	19	81.73926	0.4688312	3.518761	26	91.04832	0.1688312	5.863498	23	95.52895	0.07142857	7.185225	15	99.9645	0.06493507	8.038911	21	89.31906	0.2025974	4.573234	30	NM_138933.1	A1CF	10	"Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 1, mRNA."	ASP; APOBEC1CF; ACF65; ACF64; RP11-564C4.2; MGC163391; ACF	A1CF	2650615	Homo sapiens	RefSeq	ILMN_7300	NM_014576.2	NM_014576.2		29974	20357571	NM_014576.2	NP_055391.2	2650615	A	1893	GAGGTCTACCCAACTTTTGCAGTGACTGCCCGAGGGGATGGATATGGCAC	-	52566495-52566544	10q11.23c	"A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]; All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [pmid 12881431] [evidence IDA]; The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Protein complex that mediates editing of the mRNA encoding apolipoprotein B; catalyzes the deamination of C to U (residue 6666 in the human mRNA). Contains a catalytic subunit, APOBEC-1, and other proteins (e.g. human ASP; rat ASP and KSRP) [goid 30895] [pmid 10781591] [evidence IDA]"	Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; Any process involved in maintaining the structure and integrity of a protein and preventing it from degradation or aggregation [goid 50821] [pmid 12881431] [evidence IDA]	"Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with double-stranded RNA [goid 3725] [pmid 11871661] [evidence IDA]; Interacting selectively with single-stranded RNA [goid 3727] [pmid 11871661] [evidence IDA]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 12896982] [evidence IPI]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 10669759] [evidence IPI]"	ASP; APOBEC1CF; ACF65; ACF64; RP11-564C4.2; MGC163391; ACF
ILMN_1779670	A1CF	70.65253	0.4701299	3.550031	25	71.82597	0.4662338	4.207925	21	69.21152	0.7350649	3.501202	33	82.75872	0.3597403	7.065182	16	82.12652	0.3727273	4.536701	20	67.91729	0.8168831	3.755788	21	73.68665	0.725974	3.920706	14	75.78661	0.6818182	3.96501	23	80.98547	0.4493507	5.416678	23	73.09767	0.6883117	4.225072	18	90.81487	0.1831169	7.04958	27	85.95528	0.2948052	6.538131	16	NM_138933.1	A1CF	10	"Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 3, mRNA."	ASP; ACF65; ACF64; RP11-564C4.2; MGC163391	A1CF	5340672	Homo sapiens	RefSeq	ILMN_165661	NM_138933.1	NM_138933.1		29974	20357577	NM_138933.1	NP_620311.1	5340672	I	278	GGCACATGCCCAGAGCCAGAAGCGAGCATGAGCACAGCAATTCCTGGCCT	-	52610479-52610528	10q11.23c	"A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]; All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [pmid 12881431] [evidence IDA]; The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Protein complex that mediates editing of the mRNA encoding apolipoprotein B; catalyzes the deamination of C to U (residue 6666 in the human mRNA). Contains a catalytic subunit, APOBEC-1, and other proteins (e.g. human ASP; rat ASP and KSRP) [goid 30895] [pmid 10781591] [evidence IDA]"	Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; Any process involved in maintaining the structure and integrity of a protein and preventing it from degradation or aggregation [goid 50821] [pmid 12881431] [evidence IDA]	"Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with double-stranded RNA [goid 3725] [pmid 11871661] [evidence IDA]; Interacting selectively with single-stranded RNA [goid 3727] [pmid 11871661] [evidence IDA]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 12896982] [evidence IPI]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 10669759] [evidence IPI]"	ASP; APOBEC1CF; ACF65; ACF64; RP11-564C4.2; MGC163391; ACF
ILMN_1653355	A26C3	80.92675	0.1883117	8.109783	14	87.24876	0.07532468	6.811801	17	88.34422	0.138961	3.450279	14	95.0621	0.0987013	5.099861	26	99.67205	0.04805195	4.906904	19	86.96521	0.2012987	3.705514	23	89.49654	0.1831169	4.219081	18	101.5247	0.03896104	6.524839	27	112.0057	0.01298701	5.793777	21	110.3927	0.003896104	8.020485	18	103.9234	0.03636364	5.481992	20	94.64548	0.1	7.94016	19	NM_001005356.1	A26C3	22	"Homo sapiens ANKRD26-like family C, member 3 (A26C3), mRNA."	ACTBL1; POTE22	A26C3	2000519	Homo sapiens	RefSeq	ILMN_21001	NM_001004053.2	NM_001004053.2		23784	126090670	NM_001004053.2	NP_001004053.2	2000519	A	687	CTGCTCTACATCTGGCCTCTGCCAATGGAAATTCAGAAGTAGTAAAACTC	-	14662540-14662589	22q11.1c				POTE-14; ACTBL1; POTE22; POTE14
ILMN_1717783	A26C3	50.63603	0.9922078	3.991824	23	55.0159	0.951948	3.655843	29	60.36258	0.9350649	2.940427	14	55.14183	0.9896104	3.57995	17	58.29805	0.9727273	3.430729	20	53.85002	0.9948052	3.804089	13	57.16838	0.9883117	2.327278	26	57.7401	0.987013	3.939641	26	58.99149	0.9727273	3.337898	28	60.48242	0.9506493	4.02132	29	55.67406	0.9909091	3.272732	23	63.65988	0.9337662	3.662761	23	NM_001004053.1	A26C3	22	"Homo sapiens ANKRD26-like family C, member 3 (A26C3), mRNA."	ACTBL1; POTE22	A26C3	3870044	Homo sapiens	RefSeq	ILMN_21001	NM_001004053.2	NM_001004053.2		23784	126090670	NM_001004053.2	NP_001004053.2	3870044	S	1957	GTCATGCTAAGACTGGAACTAGACATAATGAAACATCAGAGCCAGCTAAG	-	14636561-14636610	22q11.1c				POTE22
ILMN_1705025	A26C3	68.09356	0.5909091	5.050897	21	72.42866	0.438961	5.45204	24	69.48825	0.7233766	3.857865	16	88.22652	0.2025974	5.069571	20	82.83955	0.3545454	7.663315	13	80.44049	0.3922078	5.01264	17	80.0291	0.5103896	6.038512	16	81.21796	0.4805195	5.193065	18	87.51312	0.238961	5.828823	21	79.4101	0.4545455	6.647317	11	96.59934	0.1051948	8.200867	23	78.44255	0.5428572	4.491963	28	XM_942354.1	A26C3	22	"Homo sapiens ANKRD26-like family C, member 3 (A26C3), mRNA."	ACTBL1; POTE22	A26C3	7050209	Homo sapiens	RefSeq	ILMN_21001	NM_001004053.2	NM_001004053.2		23784	126090670	NM_001004053.2	NP_001004053.2	7050209	A	701	GCCTCTGCCAATGGAAATTCAGAAGTAGTAAAACTCCTGCTGGACAGACG	-	14662526-14662575	22q11.1c