[BioC] Help about 'pairwiseAlignment' in Biostrings package

[ligang]

Hello list,

I'm using 'pairwiseAlignment' function of Biostrings package to do sequences
alignment, and found that when do local alignment, if there were several
fragments matched between 'pattern' and 'subject' sequence, only one was found
by 'pairwiseAlignment' function, see the following example:


#######################

set.seed(12345)
DNAString(paste(sample(c("A","G","C","T"),200, rep=TRUE),collapse=""))->toquery
DNAString('GCGGTGCCCGGGGCATCTCCGCGGCGGAAC')->toinsert
to.subject<-c(toquery, toinsert, subseq(toquery, start=30, end=150),toinsert)
pairwiseAlignment(subseq(toquery,start=50,end=120), to.subject)


#######################

how could I found all the "matches"?

LiGang