[BioC] Lumi mouse mapping

[Antonina Mitrofanova, PhD]

Dear List,

I am analyzing mouse Illumina data. I am interested in probes mapping to 
Akt1...  Using BeadStudio, I was able to find such a probe (nuID 
3Xqv.fD8.TUv4hRE7o, sequence 
CCTGGGGTTTTTCTTAATTTATTTCATCCAGTTTGAGACCACACATGTGG)...

when I run this sequence against BLAST, it is a perfect match to Akt1 ...

also, in the annotation files (from here 
http://www.compbio.group.cam.ac.uk/Resources/Annotation/), such as  MouseWG-
6_V2_0_R0_11278593_A, it is listed as a 100% match to Akt1 (same in the older 
versions of the annotation files)...

however, when i make a call to getSYMBOL
("3Xqv.fD8.TUv4hRE7o", 'lumiMouseAll.db'), the outcome is NA...

why is this happening?

thanks a lot!
Antonina