[BioC] Creating CDF

[James W. MacDonald]

naresh kumar wrote:
> Dear Dr.MacDonald,
> 
> Thank you very much for your reply,
> 
> I generated new probeset names by doing custom mapping of probes to 
> Genome.The output file is in csv format i need that csv file converted 
> to cdf.Is this possible  through
> 'makecdfenv' package ? otherwise if possible please provide me any kind 
> of information to do it..

No. You need to use the affxparser package:

http://article.gmane.org/gmane.science.biology.informatics.conductor/21824/match=create+cdf

Best,

Jim


> 
> I'm displaying few rows of my file to be clear.
> Probe Set Name 	Probe X 	Probe Y 	Probe Interrogation Position 	Probe 
> Sequence 	Target Strandedness 	Alignment 	Chromosome 	Transcript 	exon 
> NewProbe 	Indication
> 1007_s_at:718:317; 	718 	317 	3330 	CACCCAGCTGGTCCTGTGGATGGGA 
> Antisense 	1 	6 	uc003nrv.1 	exon16 	 chr6probe447 	s
> 1007_s_at:1105:483; 	1105 	483 	3443 	GCCCCACTGGACAACACTGATTCCT 
> Antisense 	1 	6 	uc003nrv.1 	exon16 	 chr6probe447 	s
> 1007_s_at:584:901; 	584 	901 	3512 	TGGACCCCACTGGCTGAGAATCTGG 
> Antisense 	1 	6 	uc003nrv.1 	exon16 	 chr6probe447 	s
> 1007_s_at:192:205; 	192 	205 	3563 	AAATGTTTCCTTGTGCCTGCTCCTG 
> Antisense 	1 	6 	uc003nrv.1 	exon16 	 chr6probe447 	s
> 1007_s_at:844:979; 	844 	979 	3570 	TCCTTGTGCCTGCTCCTGTACTTGT 
> Antisense 	1 	6 	uc003nrv.1 	exon16 	 chr6probe447 	s
> 1007_s_at:537:971; 	537 	971 	3576 	TGCCTGCTCCTGTACTTGTCCTCAG 
> Antisense 	1 	6 	uc003nrv.1 	exon16 	 chr6probe447 	s
> 
> 
> 
> Thanks and Regards
> Naresh
> 
> --- On *Fri, 17/7/09, James W. MacDonald /<jmacdon at med.umich.edu>/* wrote:
> 
> 
>     From: James W. MacDonald <jmacdon at med.umich.edu>
>     Subject: Re: [BioC] Creating CDF
>     To: "naresh kumar" <naresh4836 at yahoo.co..in>
>     Cc: bioconductor at stat.math.ethz.ch
>     Date: Friday, 17 July, 2009, 2:26 AM
> 
>     Hi Naresh,
> 
>     naresh kumar wrote:
>      > Dear mailing list,
>      >
>      > I got trouble in creating custom cdf in bio conductor.Could any
>     one suggest me one tool or source which creates CDF.
> 
>     Assuming that you want a cdf package for a custom CDF (where you
>     actually have the CDF from Affy), you want the makecdfenv package.
> 
>     Best,
> 
>     Jim
> 
> 
>      >
>      >
>      > Thanks for your help in advance
>      > Naresh
>      >
>      >
>      >
>      >       Looking for local information? Find it on Yahoo! Local
>     http://in.local.yahoo.com/
>      >     [[alternative HTML version deleted]]
>      >
>      > _______________________________________________
>      > Bioconductor mailing list
>      > Bioconductor at stat.math.ethz.ch
>     </mc/compose?to=Bioconductor at stat.math.ethz.ch>
>      > https://stat.ethz.ch/mailman/listinfo/bioconductor
>      > Search the archives:
>     http://news.gmane.org/gmane.science.biology.informatics.conductor
> 
>     -- James W. MacDonald, M.S.
>     Biostatistician
>     Douglas Lab
>     University of Michigan
>     Department of Human Genetics
>     5912 Buhl
>     1241 E. Catherine St.
>     Ann Arbor MI 48109-5618
>     734-615-7826
> 
> 
> ------------------------------------------------------------------------
> See the Web's breaking stories, chosen by people like you. Check out 
> Yahoo! Buzz 
> <http://in.rd.yahoo.com/tagline_buzz_1/*http://in.buzz.yahoo.com/>.

-- 
James W. MacDonald, M.S.
Biostatistician
Douglas Lab
University of Michigan
Department of Human Genetics
5912 Buhl
1241 E. Catherine St.
Ann Arbor MI 48109-5618
734-615-7826