[BioC] Inconsistent annotation of affy probeset on Affymetrix chip for rat: 230.2

[Mark Cowley]

Hi Christoph,
I would recommend obtaining the sequences of the actual probes that  
make up this probeset (from NetAffx), then align them to the latest  
genome using BLAT, thereby you can convince yourself which mRNA that  
these probes will be most likely to detect.
I find that aligning the probes often tells you far more information  
than the affymetrix consensus sequence ever wi
Be very concerned if your probes start aligning all over the genome!ll.

cheers,
Mark

On 03/07/2008, at 3:47 AM, Marc Carlson wrote:

> Christoph Preuss wrote:
>> Hi everyone,
>>
>> We analyzed a global exression microarray data set using gcrma for  
>> the
>> normalization step and limma for finding differentially expressed
>> genes. One of the most significant probesets (ProbeSetID annotation
>> "1375535_at") in terms of d.e is annotated as  :
>> Probeset "1375535_at"
>> -Gene Symbol: Lpin1
>> - Location: Chr 6
>>
>> in the bioconductor package  "rat2302" / "rat2302.db".
>>
>> We also looked at the Affymetrix web site, where the same probeset  
>> was
>> annoted as "Transcribed sequence" on chromosome X.
>>
>> Affymetrix Annotation RG 230 2.0 Chip:
>> -ProbeSetID:	1375535_at
>> -Target Sequence:	
>>
>>> RAT230_2:1375535_AT
>>>
>> gaagttagagagctgtttccccactttacattttaaaatatgtatgccaggatntaatca
>> ttcctttaagtgtacacttcaaggagagatgtgccgaataagaaaatagctttctctagc
>> gtgaagggttttgcgtccgccgagttcttaaggtcttttttaagagctactgtgtatgag
>> tgtgtgtatgtgtgcgcatgcatgttcctgcgactagtcattcattcacatggtgatcag
>> acaacaatgggagctggttcgtctaccttatcttgtgggtcctggagttcaatctcagat
>> catcaggctgggcagcaagtgccttcaccctccgagccatcttgccatcccacagctgag
>> cgtctaatatgacattgccgatga
>>
>> Interestingly, the given target sequence for the probeset matches  
>> only
>> a mouse sequence and not even a rat mRNA (blastn search).
>>
>> The question is which annotation should we trust?
>> Is there any chance to validate the probeset annotation?
>> Many thanks in advance for any help.
>>
>> cheers,
>>
>> Christoph Preuss
>>
>> (Leibniz-Institute for Arteriosclerosis Research, University of
>> Muenster Germany )
>>
>> _______________________________________________
>> Bioconductor mailing list
>> Bioconductor at stat.math.ethz.ch
>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
>>
>>
> Hi Christoph,
>
> I can only really speak for the Bioconductor annotations which are  
> generated from public sources along with an initial mapping of the  
> probe or probeset to a public accession (usually this is a Genbank,  
> Entrez ID or a related type of ID).  In the case of  "1375535_at",  
> the probeset is an Affymetrix probeset and so we are ultimately at  
> the mercy of Affymetrix to accurately tell us what this probeset is  
> in this initial mapping, but after this we do the rest ourselves by  
> using public sources.  We map the probeset to ID information onto  
> additional information gathered from public sources (primarily NCBI)  
> to get the rest of the information in the package.  The file that  
> you get from Affymetrix may also have a lot of the same data as our  
> packages, but unless they describe it somewhere, I don't think we  
> actually know for certain where they collected all of their  
> information from.  The only information that we ever actually take  
> from them is the initial mapping of their probeset onto a public  
> accession.
>
> I dug up the latest Affymetrix mapping files that we used to  
> generate this package and investigated.  From the file that I have  
> (which was collected in late March) the probeset you listed is  
> indicated to be Lpin1, and also to be located on Chromosome 6 which  
> agrees completely with the information that we gathered from NCBI   
> and GoldenPath from this time.  As of this morning, NCBI still lists  
> this gene as being Lipin1 and being located on Chromosome 6.   
> However, there is also a field right next to that in the Affymetrix  
> file that is called "Alignments" which lists the X chromosome.  But  
> when I pull up an even more recent file from Affymetrix, then I see  
> that they no longer list the location of this gene and have now  
> replaced that value with a "---", they also no longer list the genes  
> name or symbol.  But they still list Chromosome "X" in the alignment  
> field and have even assigned different accessions to this probeset.
> So the short answer is that Affymetrix has changed their mind about  
> what they are claiming this probeset is measuring.
>
>
> I hope this helps you,
>
>
>   Marc
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor