[BioC] Inconsistent annotation of affy probeset on Affymetrix chip for rat: 230.2

[James W. MacDonald]

Hi Christoph,



Christoph Preuss wrote:
> Hi everyone,
>
> We analyzed a global exression microarray data set using gcrma for the
> normalization step and limma for finding differentially expressed
> genes. One of the most significant probesets (ProbeSetID annotation
> "1375535_at") in terms of d.e is annotated as  :
> Probeset "1375535_at"
> -Gene Symbol: Lpin1
> - Location: Chr 6
>
> in the bioconductor package  "rat2302" / "rat2302.db".
>
> We also looked at the Affymetrix web site, where the same probeset was
> annoted as "Transcribed sequence" on chromosome X.
>
> Affymetrix Annotation RG 230 2.0 Chip:
> -ProbeSetID:	1375535_at
> -Target Sequence:	
>   
>> RAT230_2:1375535_AT
>>     
> gaagttagagagctgtttccccactttacattttaaaatatgtatgccaggatntaatca
> ttcctttaagtgtacacttcaaggagagatgtgccgaataagaaaatagctttctctagc
> gtgaagggttttgcgtccgccgagttcttaaggtcttttttaagagctactgtgtatgag
> tgtgtgtatgtgtgcgcatgcatgttcctgcgactagtcattcattcacatggtgatcag
> acaacaatgggagctggttcgtctaccttatcttgtgggtcctggagttcaatctcagat
> catcaggctgggcagcaagtgccttcaccctccgagccatcttgccatcccacagctgag
> cgtctaatatgacattgccgatga
>
> Interestingly, the given target sequence for the probeset matches only
> a mouse sequence and not even a rat mRNA (blastn search).
>   

Using blat, I get a near100% hit for LOC680227 on the X chromosome:

http://genome.brc.mcw.edu/cgi-bin/hgTracks?hgsid=1313763&hgt.out3=10x&position=chrX%3A91440116-91478515&hgtgroup_map_close=0&hgtgroup_phenDis_close=0&hgtgroup_genes_close=0&hgtgroup_rna_close=0&hgtgroup_regulation_close=0&hgtgroup_compGeno_close=0&hgtgroup_varRep_close=0

Note that we are just packaging existing annotation data in an easy to 
use format (using Affy's own probeset ID - Entrez Gene mapping or 
Probeset ID - UniGene mapping if EG isn't present). And it is not 
uncommon for different annotation databases to disagree. Since we are 
not purveyors of annotation data, but instead are just passing on 
existing data, it is always in your best interest to check for consistency.

Best,

Jim


> The question is which annotation should we trust?
> Is there any chance to validate the probeset annotation?
> Many thanks in advance for any help.
>
> cheers,
>
> Christoph Preuss
>
> (Leibniz-Institute for Arteriosclerosis Research, University of
> Muenster Germany )
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
>