[BioC] another quick question about Illumina annotation

[Pan Du]

Hi, Xiaoyue,

The released version of lumi Annotation packages (names started with
lumixxx) from Bioconductor were based on the EntrezID information provided
by Illumina and built by Annbuilder package. As a result, some probes do not
have EntrezID information. We will build the nuID annotation packages by
blasting RefSeq very soon. Currently, we provide a web service for nuID
annotation. Please visit this website to retrieve annotation of the nuIDs or
probe sequences. 

http://www.basic.northwestern.edu/nuID/illumina/



Pan



On 12/27/07 3:26 PM, "Zhao, Xiaoyue" <zhaox at cshl.edu> wrote:

> Hi Pan,
>  
> Sorry that I have to bother you one more question. The following probe
> sequence corresponds to a very important gene NANOG. Why is that there is no
> match after I use lookUp function? It was from the Beadstudio output.
>  
>> data <- "lumiMouseV1"
>> what <- "ENTREZID"
>> seq <- 'TCTACCAGTCCCAAACAAAAGCTCTCAAGTCCTGAGGCTGACAAGGGCCC'
>> x <- seq2id(seq)
>> lookUp(x,data=data,what=what)
> $x3FLVAQCd0LXinhCpU
> [1] NA
>  
> Thanks a lot,
> Xiaoyue
> 
>  
>