[BioC] [biocpkgs] suggestions on package matchprobes

[Xinxia Peng]

Thanks a lot! 

Maybe you can remind users that the matching is case-sensitive. For DNA
sequences, people might tend to treat the lowercase and the uppercase
the same. 

I was looking at the library "altcdfenvs" to create an alternative CDF
environment. I do not see a straightforward connection between
"altcdfenvs" and "Biostrings". Any suggestions?

BTW, my previous reply was held because this email address was not
subscribed to this list. Now it should work.

Best,
Xinxia   

-----Original Message-----
From: Wolfgang Huber [mailto:huber at ebi.ac.uk] 
Sent: Thursday, September 14, 2006 2:31 AM
To: Robert Gentleman
Cc: Xinxia Peng; Bioconductor
Subject: Re: [BioC] [biocpkgs] suggestions on package matchprobes

Hi Xinxia,

thanks!
1. The problem with the cases was simple: the function 'matchprobes'
calls C code to do the actual work, and it was:

  matchprobes <- function(query, records, probepos=FALSE)
     .Call("MP_matchprobes", toupper(query), records, probepos,
         PACKAGE="matchprobes")

I removed the "toupper" in matchprobes_1.5.1, this should make you
happier. There is no good reason why it should have been there, and that
it was not documented was a bug. So now it is gone.

2. As Robert said, for generic sequence matching please use
"Biostrings", that is much better. "matchprobes" only still exists for
backward compatibility.

 Best wishes
 Wolfgang


Robert Gentleman wrote:
> Please ask these sorts of questions on the Bioconductor mailing list -

> redirected there
> 
> and for generic sequence matching Biostrings is a better tool - we 
> will look into this, thanks Robert
> 
> Xinxia Peng wrote:
>> =+=+=+=+=+=+=+=+=+ biocpkgs mailing list +=+=+=+=+=+=+=+=+= Dear Bioc

>> Team,
>>
>> It appears that the function 'matchprobes' will not work with
sequences in lower case. Also it might be nice not to match empty
string. See the following example:
>>
>>
>>> test.seq
>>  [1]
"atggcggcgcaaagtagtggtgggggtggaggttgtggtgaggaagataaagatgccaaatatatgtttga
taggatagggaaagaagtgcacgacgaag"
>>  [2]
"atgaaaagggtaatgcaacaatttgtggatcgtacaacacaacgatttcacgaatatgatgaaaggatgaa
aactacacgccaaaaatgtaaagaacgat"
>>  [3]
"atgaaacttcactgctctaaaatattattatttttacttccattaaatatattagtaacatcattatcaaa
tgtgcataataataataaactatacaaca"
>>  [4]
"atgaaagtccattatattaatatattattgtttgctcttccattaaatatattggaacataataaaaatga
accacacaccacaccaaatcatacacaaa"
>>  [5]
"atgtttacaacaaaaaaaaaaattaaatatattataattatatgtggcatctttcgaaaatatttcaaatt
cggaagaattattgaggttccaatgatgc"
>>  [6]
"atgaaactgcactactctaatatattattatttttctttccattaaatatattagtaacatcatatcatgt
atataataaaaataaaatatacatcacac"
>>  [7]
"atgtgtgctattggagaattactatcatctacagataaggaatatactcttaatttctttggtttagttaa
agatggagcatcgattgatgaaatgaaag"
>>  [8]
"atgattaagatgaaattccattatgtaggatattattctgaagaagaaaatatgaaaaatacactgaaaat
ttgttccgttagacaaatatttttaaatt"
>>  [9]
"atgttattatttgctttattatttaatgcacttttattatcacaaaatgtaaattgccgaaacaacaatta
taatataagattcactcaaacgataacac"
>> [10]
"atgatataccacagaaggattatagcttatctcataaatcatctaccattaggtatatcccttacagaagt
ggtcgatataaatgaagaacatatattta"
>>> test.p
>> [1] "atggcggcgcaaagtagtggtgggg"
>>> matchprobes(test.seq, test.p)
>> $match
>> $match[[1]]
>> numeric(0)
>>
>> $match[[2]]
>> numeric(0)
>>
>> $match[[3]]
>> numeric(0)
>>
>> $match[[4]]
>> numeric(0)
>>
>> $match[[5]]
>> numeric(0)
>>
>> $match[[6]]
>> numeric(0)
>>
>> $match[[7]]
>> numeric(0)
>>
>> $match[[8]]
>> numeric(0)
>>
>> $match[[9]]
>> numeric(0)
>>
>> $match[[10]]
>> numeric(0)
>>
>>> matchprobes(toupper(test.seq), toupper(c(test.p, "")))
>> $match
>> $match[[1]]
>> [1] 1 2
>>
>> $match[[2]]
>> [1] 2
>>
>> $match[[3]]
>> [1] 2
>>
>> $match[[4]]
>> [1] 2
>>
>> $match[[5]]
>> [1] 2
>>
>> $match[[6]]
>> [1] 2
>>
>> $match[[7]]
>> [1] 2
>>
>> $match[[8]]
>> [1] 2
>>
>> $match[[9]]
>> [1] 2
>>
>> $match[[10]]
>> [1] 2
>>
>>
>> Thanks,
>> Xinxia Peng
>> Seattle Biomedical Research Institute
>>
>>
>>
>> __________________________________________________________________
>> biocpkgs mailing list
>> To unsubscribe from this mailing list send a blank email to 
>> biocpkgs-leave at lists.fhcrc.org You can also unsubscribe or change 
>> your personal options at 
>> http://lists.fhcrc.org/mailman/listinfo/biocpkgs
> 


--
------------------------------------------------------------------
Wolfgang Huber  EBI/EMBL  Cambridge UK  http://www.ebi.ac.uk/huber