[BioC] Question on AffyBatch

[Gunther Höning]

Hi,

that's exactly what I was looking for.

Thanks.

Gunther 

-----Ursprüngliche Nachricht-----
Von: Wolfgang Huber [mailto:huber at ebi.ac.uk] 
Gesendet: Donnerstag, 7. September 2006 07:50
An: Gunther Höning
Cc: bioconductor at stat.math.ethz.ch
Betreff: Re: [BioC] Question on AffyBatch

Gunther Höning wrote:
> Dear list,
> 
> I'm trying to find out the following in an AffyBatch.
> 
> To get the indices from a loction on a chip I use the function xy2i() 
> for the hgu133plus2 by Affymetrix.
> But now I want to know the name of the probe located at this spot. How 
> can this be done?
> And what about the locations used as QC?
> 
> Gunther

Hi Gunther,

maybe this is what you want, it finds you the annotation of the probe at
x-position 'mx' and y-position 'my', and its intensity data in the AffyBatch
'a':


library("hgu133plus2probe")
library("hgu133plus2cdf")

mx = 600
my = 713

exprs(a)[xy2i(mx, my), ]

r = with(hgu133plus2probe, x==mx & y==my) print.data.frame(
hgu133plus2probe[r,] )


                         sequence   x   y Probe.Set.Name
249549 GTAGACTACAAGTGGTTGTTACCCA 600 713      213376_at

        Probe.Interrogation.Position Target.Strandedness
249549                          870           Antisense


The explicit call to 'print.data.frame' is necessary because the print
method for 'probetable' objects is a bit dumb.

Best wishes
  Wolfgang




> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: 
> http://news.gmane.org/gmane.science.biology.informatics.conductor