[BioC] altcdfenvs

[Hee Siew Wan]

Dear All
 
I was trying to use a trial data (Dilution) to create a new cdf using "altcdfenvs". Instead of using "matchprobes", I created the "m":
 
ind <- c(seq(1,199084,by=11), seq(1,199084,by=10), seq(1,199084,by=9),
 seq(1,199084,by=8), seq(1,199084,by=7), seq(1,199084,by=6))
 
m.dil <- new.env()
m.dil$match <- list(ind[1])
m.dil$match <- c(m.dil$match, ind[2:length(ind)])
m.dil <- as.list(m.dil)
length(m.dil$match)    # [1] 146637
 
id.dil <- hgu95av2probe$Probe.Set.Name[ind]
 
dil.cdf <- buildCdfEnv.matchprobes(m.dil, id.dil, nrow.chip=640, ncol.chip=640, 
 chiptype="HG-U95Av2", probes.pack="hgu95av2probe")
 
new.dil <- Dilution[,1:2]
validAffyBatch(new.dil, dil.cdf)    # [1] TRUE
new.dil.cdfenv <- dil.cdf at envir <mailto:dil.cdf at envir> 
new.dil at cdfName <mailto:new.dil at cdfName>  <- "new.dil.cdfenv"
 
> new.dil
AffyBatch object
size of arrays=640x640 features (6405 kb)
cdf=new.dil.cdfenv (12453 affyids)
number of samples=2
number of genes=12453
annotation=hgu95av2

> length(pm(new.dil[,1]))
[1] 12453
 
As noted above, I have 12453 probe sets with my new cdf but I also have 12453 probe pairs when in fact I want 146637 probe pairs. The new cdf only returns 1 probe pair per set. Is there a way where I can have the 146637 probe pairs?
 
I tried doing the same thing for ath1121501 array. For this case, I created a data.frame from "ath1121501probe" with the following columns:
> names(newath)
[1] "sequence" "probe" "X" "Y" "position"
 
However, when I run
 
m <- matchprobes(newath$sequence, ath1121501probe$sequence)
 
I found out that for some sequences, I have more than 1 match. For example, 
 
> ath1121501probe$sequence[16023]
[1] "GAGTATGCAGTCGAGTGGTGTGATG"
> ath1121501probe$sequence[16012]
[1] "GAGTATGCAGTCGAGTGGTGTGATG"
 
Hence, the probe that I'm interested in may not be matched to the correct one.
 
The versions I'm using:
R: 1.9.0
altcdfenvs: 1.0.0
affy: 1.4.31
ath1121501probe: 1.01
 
on Windows XP Professional Version 2002.
 
Did I do something wrong along the way for both methods? I'd appreciate any help or advice regarding how to get the selected probe pairs for analysis. Also, how do I cite the package "altcdfenvs"? Thank you.
 
Regards
Hee, Siew Wan