[Bioc-sig-seq] qa error in ShortRead.

[Dario Strbenac]

Oops - I didn't do reply all.

---- Original message ----
>Date: Tue, 14 Sep 2010 22:10:55 -0700
>From: "Kunbin Qu" <KQu at genomichealth.com>  
>Subject: RE: [Bioc-sig-seq] qa error in ShortRead  
>To: <D.Strbenac at garvan.org.au>
>
>Thanks a lot, Dario. I was reading the pdf of ShortRead which has such
>usage. I tried what you suggested, it worked beautifully!
>
>
>-----Original Message-----
>From: Dario Strbenac [mailto:D.Strbenac at garvan.org.au] 
>Sent: Tuesday, September 14, 2010 10:00 PM
>To: Kunbin Qu
>Subject: Re: [Bioc-sig-seq] qa error in ShortRead
>
>Hi,
>
>qa can't be used on an object that you've created in R. You have to do
>quality assessment from disk. Also, you weren't telling the qa function
>which type of data you were giving it.
>
>You need :       qa("./", "tmp2", type = "fastq")
>
>--------------------------------------
>Dario Strbenac
>Research Assistant
>Cancer Epigenetics
>Garvan Institute of Medical Research
>Darlinghurst NSW 2010
>Australia
>
>
>---- Original message ----
>>Date: Tue, 14 Sep 2010 21:27:10 -0700
>>From: bioc-sig-sequencing-bounces at r-project.org (on behalf of "Kunbin
>Qu" <KQu at genomichealth.com>)
>>Subject: [Bioc-sig-seq] qa error in ShortRead  
>>To: <bioc-sig-sequencing at r-project.org>
>>
>>Hi, 
>>
>>I received the following error when I tried to read some fastq in and
>>generate QA report. Could anybody help me? Thanks.
>>
>>-Kunbin
>>
>>
>>[srp101]more tmp2
>>@SEQUENCER01_0007:1:1:1066:13331#0/1
>>CAGCTANCTGCGTTCTTCATCGACGCACGAGCCGAGTATTAATGTGAATTG
>>+SEQUENCER01_0007:1:1:1066:13331#0/1
>>fdfffcBccccccccfffffffeffffffcfffffedcfcffffddedfdd
>>@SEQUENCER01_0007:1:1:1066:8699#0/1
>>CTTACCNCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCAC
>>+SEQUENCER01_0007:1:1:1066:8699#0/1
>>cc^ccaBV]]ba_^Zc^cbaa`c`cL^```cb\ccc^aaaaa^aabba`bb
>>@SEQUENCER01_0007:1:1:1066:20185#0/1
>>GCCACANACACCTGATTATCAACAGCCCGGCTTCGCTGAAGTAACTCCCAA
>>+SEQUENCER01_0007:1:1:1066:20185#0/1
>>fffffbBbbbcccccfffffefffffffffeffffffffefffffdefffd
>>[srp101]
>>
>>
>>> s6<-readFastq("./", "tmp2")
>>> q6<-qa(s6)
>>Error: UserArgumentMismatch
>>  'lane' must be 'character(1)'
>>
>>
>>> sessionInfo()
>>R version 2.11.0 (2010-04-22) 
>>x86_64-unknown-linux-gnu 
>>
>>locale:
>> [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              
>> [3] LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8    
>> [5] LC_MONETARY=C              LC_MESSAGES=en_US.UTF-8   
>> [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 
>> [9] LC_ADDRESS=C               LC_TELEPHONE=C            
>>[11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
>>
>>attached base packages:
>>[1] stats     graphics  grDevices utils     datasets  methods   base
>>
>>
>>other attached packages:
>>[1] ShortRead_1.6.2     Rsamtools_1.0.1     lattice_0.18-8     
>>[4] Biostrings_2.16.7   GenomicRanges_1.0.1 IRanges_1.6.8      
>>
>>loaded via a namespace (and not attached):
>>[1] Biobase_2.8.0 grid_2.11.0   hwriter_1.2  
>>>
>>
>>______________________________________________________________________
>>The contents of this electronic message, including any attachments, are
>intended only for the use of the individual or entity to which they are
>addressed and may contain confidential information. If you are not the
>intended recipient, you are hereby notified that any use, dissemination,
>distribution, or copying of this message or any attachment is strictly
>prohibited. If you have received this transmission in error, please send
>an e-mail to postmaster at genomichealth.com and delete this message, along
>with any attachments, from your computer.
>>
>>_______________________________________________
>>Bioc-sig-sequencing mailing list
>>Bioc-sig-sequencing at r-project.org
>>https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
>
>______________________________________________________________________
>The contents of this electronic message, including any attachments, are intended only for the use of the individual or entity to which they are addressed and may contain confidential information. If you are not the intended recipient, you are hereby notified that any use, dissemination, distribution, or copying of this message or any attachment is strictly prohibited. If you have received this transmission in error, please send an e-mail to postmaster at genomichealth.com and delete this message, along with any attachments, from your computer.