[Bioc-devel] error in subsetting "ShortReadQ" object

[Valerie Obenchain]

The 'GroupedIRanges' error is related to some cleanup Herve is doing on 
the subsetting code in IRanges/XVector. The error should be gone with 
the most recent devel versions (IRanges 1.19.33, XVector 0.1.2, 
GenomicRanges 1.13.42). These may take a day to propagate through 
biocLite().

Valerie


On 09/12/2013 08:06 AM, Kasper Daniel Hansen wrote:
> We are getting hit hard by this in minfi as well, assuming this is fall out
> from us using SummarizedExperiment.
>
> Best,
> Kasper
>
>
> On Thu, Sep 12, 2013 at 7:16 AM, Stadler, Michael <Michael.Stadler at fmi.ch>wrote:
>
>> Dear list and ShortRead maintainers,
>>
>> Since I updated BioC 2.13 yesterday to the latest package versions, I am
>> experiencing errors when trying to build the QuasR vignette.
>>
>> It seems the error is caused in QuasR::preprocessReads(), which tries to
>> subset a ShortRead::ShortReadQ object with a logical vector.
>>
>> The problem does not seem to be QuasR related and can be reproduced with a
>> minimal example:
>>
>> library(ShortRead)
>> seqFile <- tempfile(fileext=".fq")
>>
>> writeLines(c("@seq1/1","AAAGGCCACACTTTTGAAAAAAGAAAAACAAGAATAAGCCCTGTTGCTCT","+","ggggggggggggggggggfffffffffggggggggggggggggggggggg",
>>
>>   "@seq2/1","CTGCCGTAATATTCAGCTCCCTGAGCTGAGCCTTGAGGTCCGAGTTCATC","+","ghgggggggggggggggggfgggfggggggggggggfggggggggggggg",
>>
>>   "@seq3/1","GTTCCACATTGTTCTGCTGTGCTTTGTCCAAATGAACCTTTATGAGCCGG","+","gggggggggggggggggggggggggggggggggggggggggggggggggg",
>>
>>   "@seq4/1","CGGGAGATTCACCAGGACTGGGCTGACCAGGAGTACATTGAGATAATCAC","+","eggegddceedggggeZcec^]`^`ffffcTTSUTTSSTTfffaf]``]^"),
>>             seqFile)
>> fs1 <- FastqStreamer(seqFile)
>> chunks <- yield(fs1)
>> chunks[c(T,F,T,F)] # ERROR
>> chunks[1:2] # ERROR
>> close(fs1)
>>
>> The error message is:
>> Error in validObject(.Object) :
>>    invalid class “GroupedIRanges” object: slot "group" slot must have same
>> length as object
>>
>> My environment is:
>> R version 3.0.1 (2013-05-16)
>> Platform: x86_64-apple-darwin10.8.0 (64-bit)
>>
>> locale:
>> [1] C/UTF-8/C/C/C/C
>>
>> attached base packages:
>> [1] parallel  stats     graphics  grDevices utils     datasets  methods
>> [8] base
>>
>> other attached packages:
>>   [1] ShortRead_1.19.10     latticeExtra_0.6-26   RColorBrewer_1.0-5
>>   [4] Rsamtools_1.13.39     lattice_0.20-23       Biostrings_2.29.16
>>   [7] GenomicRanges_1.13.41 XVector_0.1.1         IRanges_1.19.32
>> [10] BiocGenerics_0.7.5
>>
>> loaded via a namespace (and not attached):
>> [1] Biobase_2.21.7 bitops_1.0-6   grid_3.0.1     hwriter_1.3
>>   stats4_3.0.1
>> [6] tools_3.0.1    zlibbioc_1.7.0
>>
>> Any help would be highly appreciated.
>> Michael
>>
>> _______________________________________________
>> Bioc-devel at r-project.org mailing list
>> https://stat.ethz.ch/mailman/listinfo/bioc-devel
>>
>
> 	[[alternative HTML version deleted]]
>
>
>
> _______________________________________________
> Bioc-devel at r-project.org mailing list
> https://stat.ethz.ch/mailman/listinfo/bioc-devel
>