[Bioc-devel] error in subsetting "ShortReadQ" object

[Stadler, Michael]

Dear list and ShortRead maintainers,

Since I updated BioC 2.13 yesterday to the latest package versions, I am experiencing errors when trying to build the QuasR vignette.

It seems the error is caused in QuasR::preprocessReads(), which tries to subset a ShortRead::ShortReadQ object with a logical vector.

The problem does not seem to be QuasR related and can be reproduced with a minimal example:

library(ShortRead)
seqFile <- tempfile(fileext=".fq")
writeLines(c("@seq1/1","AAAGGCCACACTTTTGAAAAAAGAAAAACAAGAATAAGCCCTGTTGCTCT","+","ggggggggggggggggggfffffffffggggggggggggggggggggggg",
             "@seq2/1","CTGCCGTAATATTCAGCTCCCTGAGCTGAGCCTTGAGGTCCGAGTTCATC","+","ghgggggggggggggggggfgggfggggggggggggfggggggggggggg",
             "@seq3/1","GTTCCACATTGTTCTGCTGTGCTTTGTCCAAATGAACCTTTATGAGCCGG","+","gggggggggggggggggggggggggggggggggggggggggggggggggg",
             "@seq4/1","CGGGAGATTCACCAGGACTGGGCTGACCAGGAGTACATTGAGATAATCAC","+","eggegddceedggggeZcec^]`^`ffffcTTSUTTSSTTfffaf]``]^"),
           seqFile)
fs1 <- FastqStreamer(seqFile)
chunks <- yield(fs1)
chunks[c(T,F,T,F)] # ERROR
chunks[1:2] # ERROR
close(fs1)

The error message is:
Error in validObject(.Object) : 
  invalid class “GroupedIRanges” object: slot "group" slot must have same length as object

My environment is:
R version 3.0.1 (2013-05-16)
Platform: x86_64-apple-darwin10.8.0 (64-bit)

locale:
[1] C/UTF-8/C/C/C/C

attached base packages:
[1] parallel  stats     graphics  grDevices utils     datasets  methods  
[8] base     

other attached packages:
 [1] ShortRead_1.19.10     latticeExtra_0.6-26   RColorBrewer_1.0-5   
 [4] Rsamtools_1.13.39     lattice_0.20-23       Biostrings_2.29.16   
 [7] GenomicRanges_1.13.41 XVector_0.1.1         IRanges_1.19.32      
[10] BiocGenerics_0.7.5   

loaded via a namespace (and not attached):
[1] Biobase_2.21.7 bitops_1.0-6   grid_3.0.1     hwriter_1.3    stats4_3.0.1  
[6] tools_3.0.1    zlibbioc_1.7.0

Any help would be highly appreciated.
Michael